\
| Variant ID: vg0214609392 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 14609392 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGTATTACTTCTTGATTAAGAAGGCCTGAACCTGTATAAAATTCCTTTTCTCTAAACCCATCCACTTTTCTAGCTTGATAGCCACCCCCTTTTAGTATTG[C/T]
CGAAATCTTGTTTCGACAGGCAGTGATGGTGGGCTCAGGAGACGACGGGAGGGGCCTCCAAACGCACAGATCCCACCACCTCTCTCCCTCATCATCTTCG
CGAAGATGATGAGGGAGAGAGGTGGTGGGATCTGTGCGTTTGGAGGCCCCTCCCGTCGTCTCCTGAGCCCACCATCACTGCCTGTCGAAACAAGATTTCG[G/A]
CAATACTAAAAGGGGGTGGCTATCAAGCTAGAAAAGTGGATGGGTTTAGAGAAAAGGAATTTTATACAGGTTCAGGCCTTCTTAATCAAGAAGTAATACC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 37.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.70% | 3.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0214609392 | C -> T | LOC_Os02g25140.1 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:48.077; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0214609392 | C -> T | LOC_Os02g25150.1 | upstream_gene_variant ; 2717.0bp to feature; MODIFIER | silent_mutation | Average:48.077; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0214609392 | C -> T | LOC_Os02g25140-LOC_Os02g25150 | intergenic_region ; MODIFIER | silent_mutation | Average:48.077; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0214609392 | 1.08E-06 | 1.42E-06 | mr1125 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214609392 | 2.92E-06 | 8.79E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214609392 | 8.11E-08 | 4.54E-07 | mr1758 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |