\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214438331:

Variant ID: vg0214438331 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14438331
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGGCCGCTCTGCCTCCCGCCGAGCACTATGTGGGTACCCTGTTCACTGTTGACGGTCGGTATCGATCAGTTTCGACCGTCAATATTACCAAAATAGAG[A/G]
AGATCTAGTGATGCTTGCAATGCATAAATGTATTAGAATAATAAGCCTCCACTAGTATTAGGCATACTAACCTCTTGCAGGGAATGACACTAAAGTGGAG

Reverse complement sequence

CTCCACTTTAGTGTCATTCCCTGCAAGAGGTTAGTATGCCTAATACTAGTGGAGGCTTATTATTCTAATACATTTATGCATTGCAAGCATCACTAGATCT[T/C]
CTCTATTTTGGTAATATTGACGGTCGAAACTGATCGATACCGACCGTCAACAGTGAACAGGGTACCCACATAGTGCTCGGCGGGAGGCAGAGCGGCCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.10% 9.60% 2.31% 0.00% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 63.70% 29.40% 6.94% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 34.20% 55.10% 10.69% 0.00% NA
Tropical Japonica  504 96.80% 1.20% 1.98% 0.00% NA
Japonica Intermediate  241 88.40% 6.20% 5.39% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214438331 A -> G LOC_Os02g24910.1 upstream_gene_variant ; 915.0bp to feature; MODIFIER silent_mutation Average:52.04; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg0214438331 A -> G LOC_Os02g24890.1 downstream_gene_variant ; 2845.0bp to feature; MODIFIER silent_mutation Average:52.04; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg0214438331 A -> G LOC_Os02g24900.1 downstream_gene_variant ; 1129.0bp to feature; MODIFIER silent_mutation Average:52.04; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg0214438331 A -> G LOC_Os02g24900-LOC_Os02g24910 intergenic_region ; MODIFIER silent_mutation Average:52.04; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214438331 NA 1.09E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0214438331 NA 1.34E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0214438331 NA 4.31E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 3.22E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 1.32E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 8.72E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 5.15E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 2.03E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 6.13E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 3.62E-06 NA mr1627_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 7.10E-10 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 6.85E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214438331 NA 1.80E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251