\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214372057:

Variant ID: vg0214372057 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14372057
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCAACCATGGAAACAGAGCTGACGGTACTAGATACTGCTACTGTTGAGGCAGAATAGCTGCGTGATCTATTAATGGATCTGCCTATTGTTGAAAAACC[G/A]
GTGCCGGCTATCCTTATGAACTGTGACAATCAAACGGTAATTGTCAAAGTGAATAGTTCTAAGGATAATATGAAATCGTCTAGACATGTGAAAAGACGAT

Reverse complement sequence

ATCGTCTTTTCACATGTCTAGACGATTTCATATTATCCTTAGAACTATTCACTTTGACAATTACCGTTTGATTGTCACAGTTCATAAGGATAGCCGGCAC[C/T]
GGTTTTTCAACAATAGGCAGATCCATTAATAGATCACGCAGCTATTCTGCCTCAACAGTAGCAGTATCTAGTACCGTCAGCTCTGTTTCCATGGTTGACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 1.70% 0.30% 0.00% NA
All Indica  2759 96.70% 2.90% 0.43% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 88.00% 11.00% 1.08% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 96.70% 2.90% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214372057 G -> A LOC_Os02g24770.1 downstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:40.971; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0214372057 G -> A LOC_Os02g24780.1 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:40.971; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0214372057 G -> A LOC_Os02g24770-LOC_Os02g24780 intergenic_region ; MODIFIER silent_mutation Average:40.971; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214372057 NA 4.24E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 2.86E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 2.53E-07 1.29E-10 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 7.94E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 2.01E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 2.51E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 1.77E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 2.17E-06 1.30E-06 mr1818_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 6.34E-08 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 7.70E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 4.95E-08 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214372057 NA 7.86E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251