\
| Variant ID: vg0214372057 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 14372057 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )
GGTCAACCATGGAAACAGAGCTGACGGTACTAGATACTGCTACTGTTGAGGCAGAATAGCTGCGTGATCTATTAATGGATCTGCCTATTGTTGAAAAACC[G/A]
GTGCCGGCTATCCTTATGAACTGTGACAATCAAACGGTAATTGTCAAAGTGAATAGTTCTAAGGATAATATGAAATCGTCTAGACATGTGAAAAGACGAT
ATCGTCTTTTCACATGTCTAGACGATTTCATATTATCCTTAGAACTATTCACTTTGACAATTACCGTTTGATTGTCACAGTTCATAAGGATAGCCGGCAC[C/T]
GGTTTTTCAACAATAGGCAGATCCATTAATAGATCACGCAGCTATTCTGCCTCAACAGTAGCAGTATCTAGTACCGTCAGCTCTGTTTCCATGGTTGACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.00% | 1.70% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 96.70% | 2.90% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 88.00% | 11.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 2.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0214372057 | G -> A | LOC_Os02g24770.1 | downstream_gene_variant ; 104.0bp to feature; MODIFIER | silent_mutation | Average:40.971; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0214372057 | G -> A | LOC_Os02g24780.1 | downstream_gene_variant ; 2777.0bp to feature; MODIFIER | silent_mutation | Average:40.971; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0214372057 | G -> A | LOC_Os02g24770-LOC_Os02g24780 | intergenic_region ; MODIFIER | silent_mutation | Average:40.971; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0214372057 | NA | 4.24E-07 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 2.86E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | 2.53E-07 | 1.29E-10 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 7.94E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 2.01E-06 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 2.51E-06 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 1.77E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | 2.17E-06 | 1.30E-06 | mr1818_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 6.34E-08 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 7.70E-06 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 4.95E-08 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214372057 | NA | 7.86E-07 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |