| Variant ID: vg0214216570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 14216570 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAAGGCCCTGAACCCACACGAACCTGGCTTAACCCAAGGCCTATGATGATTCAGACCAAACTGGCAACCCGACCTAGGTCCCAGCTCGTCCCAAGCCAA[C/T]
CTAGGCCAACCATTCCACATTTTAGTTGTTAAGCAAGTTTTAAGAATTAAACCACTAACTTGGGTACATTGCTAGGCTTGCCCATAACCGAGGGCGCGGC
GCCGCGCCCTCGGTTATGGGCAAGCCTAGCAATGTACCCAAGTTAGTGGTTTAATTCTTAAAACTTGCTTAACAACTAAAATGTGGAATGGTTGGCCTAG[G/A]
TTGGCTTGGGACGAGCTGGGACCTAGGTCGGGTTGCCAGTTTGGTCTGAATCATCATAGGCCTTGGGTTAAGCCAGGTTCGTGTGGGTTCAGGGCCTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 0.30% | 2.14% | 23.30% | NA |
| All Indica | 2759 | 58.20% | 0.60% | 3.41% | 37.80% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.07% | 0.66% | NA |
| Aus | 269 | 86.20% | 0.00% | 2.23% | 11.52% | NA |
| Indica I | 595 | 50.30% | 0.00% | 1.51% | 48.24% | NA |
| Indica II | 465 | 56.10% | 0.00% | 3.44% | 40.43% | NA |
| Indica III | 913 | 66.50% | 1.10% | 4.82% | 27.60% | NA |
| Indica Intermediate | 786 | 55.90% | 0.80% | 3.18% | 40.20% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 83.30% | 0.00% | 0.00% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0214216570 | C -> T | LOC_Os02g24520.1 | upstream_gene_variant ; 3791.0bp to feature; MODIFIER | silent_mutation | Average:17.204; most accessible tissue: Callus, score: 40.907 | N | N | N | N |
| vg0214216570 | C -> T | LOC_Os02g24530.1 | upstream_gene_variant ; 1119.0bp to feature; MODIFIER | silent_mutation | Average:17.204; most accessible tissue: Callus, score: 40.907 | N | N | N | N |
| vg0214216570 | C -> T | LOC_Os02g24540.1 | downstream_gene_variant ; 3495.0bp to feature; MODIFIER | silent_mutation | Average:17.204; most accessible tissue: Callus, score: 40.907 | N | N | N | N |
| vg0214216570 | C -> T | LOC_Os02g24530-LOC_Os02g24540 | intergenic_region ; MODIFIER | silent_mutation | Average:17.204; most accessible tissue: Callus, score: 40.907 | N | N | N | N |
| vg0214216570 | C -> DEL | N | N | silent_mutation | Average:17.204; most accessible tissue: Callus, score: 40.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0214216570 | 7.86E-07 | NA | mr1098_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214216570 | 1.12E-06 | NA | mr1150_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214216570 | 2.04E-06 | 2.04E-06 | mr1292_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214216570 | 9.67E-06 | NA | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |