\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214182384:

Variant ID: vg0214182384 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14182384
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GACAGGCTATATGATCAGGGGCTTACTAGTTCAAACACAAGTATCATACCTTCAATTTGGACTTGTTCCGGATACATGCAACATGAATTCATGATCATGG[A/G,T]
TTTATTTTCTATGCTCAAAGACTGGACTATTTATTATTCCCCGTAAGGGTTATCAACCAAATACTTGCGCCAGTCGGGATTCAATCTTTATATCTATTTT

Reverse complement sequence

AAAATAGATATAAAGATTGAATCCCGACTGGCGCAAGTATTTGGTTGATAACCCTTACGGGGAATAATAAATAGTCCAGTCTTTGAGCATAGAAAATAAA[T/C,A]
CCATGATCATGAATTCATGTTGCATGTATCCGGAACAAGTCCAAATTGAAGGTATGATACTTGTGTTTGAACTAGTAAGCCCCTGATCATATAGCCTGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.60% 9.60% 18.94% 34.85% NA
All Indica  2759 3.80% 12.80% 29.50% 53.86% NA
All Japonica  1512 98.60% 0.10% 0.33% 0.93% NA
Aus  269 2.20% 29.70% 22.30% 45.72% NA
Indica I  595 3.70% 9.10% 24.20% 63.03% NA
Indica II  465 5.80% 12.00% 28.82% 53.33% NA
Indica III  913 2.10% 14.10% 33.08% 50.71% NA
Indica Intermediate  786 4.70% 14.60% 29.77% 50.89% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 98.20% 0.20% 0.79% 0.79% NA
Japonica Intermediate  241 97.90% 0.40% 0.41% 1.24% NA
VI/Aromatic  96 75.00% 16.70% 6.25% 2.08% NA
Intermediate  90 60.00% 4.40% 11.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214182384 A -> G LOC_Os02g24480.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:14.678; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0214182384 A -> G LOC_Os02g24480-LOC_Os02g24490 intergenic_region ; MODIFIER silent_mutation Average:14.678; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0214182384 A -> T LOC_Os02g24480.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER N Average:14.678; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0214182384 A -> T LOC_Os02g24480-LOC_Os02g24490 intergenic_region ; MODIFIER N Average:14.678; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0214182384 A -> DEL N N silent_mutation Average:14.678; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214182384 NA 1.64E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.89E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 9.31E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 5.14E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.91E-36 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.71E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 5.88E-61 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.65E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.28E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 7.72E-40 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.09E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.12E-102 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 3.13E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 5.31E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.08E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 6.59E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 3.42E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.52E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 5.83E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 7.09E-38 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.94E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.81E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.05E-45 mr1591_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.63E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.68E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 1.10E-08 mr1600_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 6.06E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.92E-24 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.44E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.33E-49 mr1890_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 2.54E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214182384 NA 5.54E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251