Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214178528:

Variant ID: vg0214178528 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 14178528
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCGCTTCGGTCTTCACCCGGCCAACACAGCCCGACTACGCTGCTTCCGCCGCGGGCTCGGGAGTTTCGCCTTTGTGCGCCGCCGCCTCATCCGCTGCC[A/G]
ACTGATGTTTCCGCCTGCACGGTTGGCCTATTATGCCATCGTCCATGGGCGTCCACATCTTCACCGACCGGCTGGCATTTGTCACCGCCGACTGGTGTTC

Reverse complement sequence

GAACACCAGTCGGCGGTGACAAATGCCAGCCGGTCGGTGAAGATGTGGACGCCCATGGACGATGGCATAATAGGCCAACCGTGCAGGCGGAAACATCAGT[T/C]
GGCAGCGGATGAGGCGGCGGCGCACAAAGGCGAAACTCCCGAGCCCGCGGCGGAAGCAGCGTAGTCGGGCTGTGTTGGCCGGGTGAAGACCGAAGCGCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	35.50%	2.16%	6.96%	NA
All Indica	2759	87.40%	2.70%	2.79%	7.14%	NA
All Japonica	1512	0.70%	93.80%	0.79%	4.70%	NA
Aus	269	60.20%	24.90%	1.86%	13.01%	NA
Indica I	595	90.60%	0.20%	4.54%	4.71%	NA
Indica II	465	86.50%	2.60%	2.37%	8.60%	NA
Indica III	913	87.80%	2.60%	1.64%	7.89%	NA
Indica Intermediate	786	85.00%	4.70%	3.05%	7.25%	NA
Temperate Japonica	767	0.40%	97.00%	0.65%	1.96%	NA
Tropical Japonica	504	0.80%	90.30%	0.99%	7.94%	NA
Japonica Intermediate	241	1.70%	90.90%	0.83%	6.64%	NA
VI/Aromatic	96	2.10%	82.30%	5.21%	10.42%	NA
Intermediate	90	32.20%	46.70%	3.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0214178528	A -> G	LOC_Os02g24460.1	upstream_gene_variant ; 4369.0bp to feature; MODIFIER	silent_mutation	Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178528	A -> G	LOC_Os02g24480.1	upstream_gene_variant ; 45.0bp to feature; MODIFIER	silent_mutation	Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178528	A -> G	LOC_Os02g24470.1	downstream_gene_variant ; 1940.0bp to feature; MODIFIER	silent_mutation	Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178528	A -> G	LOC_Os02g24470-LOC_Os02g24480	intergenic_region ; MODIFIER	silent_mutation	Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0214178528	A -> DEL	N	N	silent_mutation	Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0214178528	NA	1.50E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528	3.04E-06	NA	mr1445_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528	NA	7.86E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528	5.52E-06	NA	mr1462_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528	NA	3.59E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528	NA	3.62E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528	NA	2.29E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251