\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214178528:

Variant ID: vg0214178528 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14178528
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCGCTTCGGTCTTCACCCGGCCAACACAGCCCGACTACGCTGCTTCCGCCGCGGGCTCGGGAGTTTCGCCTTTGTGCGCCGCCGCCTCATCCGCTGCC[A/G]
ACTGATGTTTCCGCCTGCACGGTTGGCCTATTATGCCATCGTCCATGGGCGTCCACATCTTCACCGACCGGCTGGCATTTGTCACCGCCGACTGGTGTTC

Reverse complement sequence

GAACACCAGTCGGCGGTGACAAATGCCAGCCGGTCGGTGAAGATGTGGACGCCCATGGACGATGGCATAATAGGCCAACCGTGCAGGCGGAAACATCAGT[T/C]
GGCAGCGGATGAGGCGGCGGCGCACAAAGGCGAAACTCCCGAGCCCGCGGCGGAAGCAGCGTAGTCGGGCTGTGTTGGCCGGGTGAAGACCGAAGCGCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 35.50% 2.16% 6.96% NA
All Indica  2759 87.40% 2.70% 2.79% 7.14% NA
All Japonica  1512 0.70% 93.80% 0.79% 4.70% NA
Aus  269 60.20% 24.90% 1.86% 13.01% NA
Indica I  595 90.60% 0.20% 4.54% 4.71% NA
Indica II  465 86.50% 2.60% 2.37% 8.60% NA
Indica III  913 87.80% 2.60% 1.64% 7.89% NA
Indica Intermediate  786 85.00% 4.70% 3.05% 7.25% NA
Temperate Japonica  767 0.40% 97.00% 0.65% 1.96% NA
Tropical Japonica  504 0.80% 90.30% 0.99% 7.94% NA
Japonica Intermediate  241 1.70% 90.90% 0.83% 6.64% NA
VI/Aromatic  96 2.10% 82.30% 5.21% 10.42% NA
Intermediate  90 32.20% 46.70% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214178528 A -> G LOC_Os02g24460.1 upstream_gene_variant ; 4369.0bp to feature; MODIFIER silent_mutation Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178528 A -> G LOC_Os02g24480.1 upstream_gene_variant ; 45.0bp to feature; MODIFIER silent_mutation Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178528 A -> G LOC_Os02g24470.1 downstream_gene_variant ; 1940.0bp to feature; MODIFIER silent_mutation Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178528 A -> G LOC_Os02g24470-LOC_Os02g24480 intergenic_region ; MODIFIER silent_mutation Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178528 A -> DEL N N silent_mutation Average:29.962; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214178528 NA 1.50E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528 3.04E-06 NA mr1445_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528 NA 7.86E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528 5.52E-06 NA mr1462_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528 NA 3.59E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528 NA 3.62E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178528 NA 2.29E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251