\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214178491:

Variant ID: vg0214178491 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14178491
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGGGCAAGCACGACCTGGATGTGACGCCGCACGTCGGGCGCTTCGGTCTTCACCCGGCCAACACAGCCCGACTACGCTGCTTCCGCCGCGGGCTCGGG[A/G]
GTTTCGCCTTTGTGCGCCGCCGCCTCATCCGCTGCCAACTGATGTTTCCGCCTGCACGGTTGGCCTATTATGCCATCGTCCATGGGCGTCCACATCTTCA

Reverse complement sequence

TGAAGATGTGGACGCCCATGGACGATGGCATAATAGGCCAACCGTGCAGGCGGAAACATCAGTTGGCAGCGGATGAGGCGGCGGCGCACAAAGGCGAAAC[T/C]
CCCGAGCCCGCGGCGGAAGCAGCGTAGTCGGGCTGTGTTGGCCGGGTGAAGACCGAAGCGCCCGACGTGCGGCGTCACATCCAGGTCGTGCTTGCCCTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 38.40% 3.26% 7.24% NA
All Indica  2759 81.00% 4.00% 5.04% 10.00% NA
All Japonica  1512 0.70% 98.40% 0.00% 0.86% NA
Aus  269 53.20% 26.40% 4.83% 15.61% NA
Indica I  595 83.20% 1.00% 6.39% 9.41% NA
Indica II  465 82.80% 3.90% 3.87% 9.46% NA
Indica III  913 81.30% 3.50% 4.82% 10.41% NA
Indica Intermediate  786 77.90% 6.90% 4.96% 10.31% NA
Temperate Japonica  767 0.40% 99.10% 0.00% 0.52% NA
Tropical Japonica  504 0.80% 97.60% 0.00% 1.59% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 27.80% 58.90% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214178491 A -> G LOC_Os02g24460.1 upstream_gene_variant ; 4332.0bp to feature; MODIFIER silent_mutation Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178491 A -> G LOC_Os02g24480.1 upstream_gene_variant ; 82.0bp to feature; MODIFIER silent_mutation Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178491 A -> G LOC_Os02g24470.1 downstream_gene_variant ; 1903.0bp to feature; MODIFIER silent_mutation Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178491 A -> G LOC_Os02g24470-LOC_Os02g24480 intergenic_region ; MODIFIER silent_mutation Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0214178491 A -> DEL N N silent_mutation Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214178491 NA 9.97E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 NA 2.23E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 2.12E-06 NA mr1445_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 5.10E-06 4.21E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 NA 4.80E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 NA 6.37E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 NA 4.39E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 NA 9.14E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214178491 NA 2.09E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251