\
| Variant ID: vg0214178491 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 14178491 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 119. )
CTAGGGCAAGCACGACCTGGATGTGACGCCGCACGTCGGGCGCTTCGGTCTTCACCCGGCCAACACAGCCCGACTACGCTGCTTCCGCCGCGGGCTCGGG[A/G]
GTTTCGCCTTTGTGCGCCGCCGCCTCATCCGCTGCCAACTGATGTTTCCGCCTGCACGGTTGGCCTATTATGCCATCGTCCATGGGCGTCCACATCTTCA
TGAAGATGTGGACGCCCATGGACGATGGCATAATAGGCCAACCGTGCAGGCGGAAACATCAGTTGGCAGCGGATGAGGCGGCGGCGCACAAAGGCGAAAC[T/C]
CCCGAGCCCGCGGCGGAAGCAGCGTAGTCGGGCTGTGTTGGCCGGGTGAAGACCGAAGCGCCCGACGTGCGGCGTCACATCCAGGTCGTGCTTGCCCTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 38.40% | 3.26% | 7.24% | NA |
| All Indica | 2759 | 81.00% | 4.00% | 5.04% | 10.00% | NA |
| All Japonica | 1512 | 0.70% | 98.40% | 0.00% | 0.86% | NA |
| Aus | 269 | 53.20% | 26.40% | 4.83% | 15.61% | NA |
| Indica I | 595 | 83.20% | 1.00% | 6.39% | 9.41% | NA |
| Indica II | 465 | 82.80% | 3.90% | 3.87% | 9.46% | NA |
| Indica III | 913 | 81.30% | 3.50% | 4.82% | 10.41% | NA |
| Indica Intermediate | 786 | 77.90% | 6.90% | 4.96% | 10.31% | NA |
| Temperate Japonica | 767 | 0.40% | 99.10% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 0.80% | 97.60% | 0.00% | 1.59% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 27.80% | 58.90% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0214178491 | A -> G | LOC_Os02g24460.1 | upstream_gene_variant ; 4332.0bp to feature; MODIFIER | silent_mutation | Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0214178491 | A -> G | LOC_Os02g24480.1 | upstream_gene_variant ; 82.0bp to feature; MODIFIER | silent_mutation | Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0214178491 | A -> G | LOC_Os02g24470.1 | downstream_gene_variant ; 1903.0bp to feature; MODIFIER | silent_mutation | Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0214178491 | A -> G | LOC_Os02g24470-LOC_Os02g24480 | intergenic_region ; MODIFIER | silent_mutation | Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0214178491 | A -> DEL | N | N | silent_mutation | Average:30.262; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0214178491 | NA | 9.97E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | NA | 2.23E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | 2.12E-06 | NA | mr1445_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | 5.10E-06 | 4.21E-06 | mr1445_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | NA | 4.80E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | NA | 6.37E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | NA | 4.39E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | NA | 9.14E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214178491 | NA | 2.09E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |