\
| Variant ID: vg0214173791 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 14173791 |
| Reference Allele: TGG | Alternative Allele: CGG,T |
| Primary Allele: CGG | Secondary Allele: TGG |
Inferred Ancestral Allele: Not determined.
ACAAACATGATATAAAAGACACATCTTTATTATATCGATAATATTTACATTATTACAAAGGCACTTCAGGCCTATGGCTCCATCTTCACAGGCGCTCAAC[TGG/CGG,T]
GGTATAAGCCATGGCTCCACCTAAACTTCTTCTCCAAAGCTTTACTGAAGGGGGTGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGTC
GACTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCACCCCCTTCAGTAAAGCTTTGGAGAAGAAGTTTAGGTGGAGCCATGGCTTATACC[CCA/CCG,A]
GTTGAGCGCCTGTGAAGATGGAGCCATAGGCCTGAAGTGCCTTTGTAATAATGTAAATATTATCGATATAATAAAGATGTGTCTTTTATATCATGTTTGT
| Populations | Population Size | Frequency of CGG(primary allele) | Frequency of TGG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 37.50% | 0.17% | 0.15% | T: 0.42% |
| All Indica | 2759 | 96.10% | 2.80% | 0.22% | 0.14% | T: 0.72% |
| All Japonica | 1512 | 1.70% | 98.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.80% | 0.22% | 0.22% | NA |
| Indica III | 913 | 95.40% | 2.50% | 0.22% | 0.11% | T: 1.75% |
| Indica Intermediate | 786 | 93.90% | 5.10% | 0.25% | 0.25% | T: 0.51% |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 95.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 43.30% | 53.30% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0214173791 | TGG -> CGG | LOC_Os02g24470.1 | upstream_gene_variant ; 2324.0bp to feature; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> CGG | LOC_Os02g24480.1 | upstream_gene_variant ; 4782.0bp to feature; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> CGG | LOC_Os02g24430.2 | downstream_gene_variant ; 2009.0bp to feature; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> CGG | LOC_Os02g24460.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> T | LOC_Os02g24470.1 | upstream_gene_variant ; 2323.0bp to feature; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> T | LOC_Os02g24480.1 | upstream_gene_variant ; 4781.0bp to feature; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> T | LOC_Os02g24430.2 | downstream_gene_variant ; 2010.0bp to feature; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> T | LOC_Os02g24460.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0214173791 | TGG -> DEL | N | N | silent_mutation | Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0214173791 | NA | 3.19E-17 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214173791 | 5.65E-07 | 2.19E-06 | mr1622_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214173791 | NA | 1.45E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214173791 | NA | 2.72E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0214173791 | NA | 1.59E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |