\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214173791:

Variant ID: vg0214173791 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 14173791
Reference Allele: TGGAlternative Allele: CGG,T
Primary Allele: CGGSecondary Allele: TGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAAACATGATATAAAAGACACATCTTTATTATATCGATAATATTTACATTATTACAAAGGCACTTCAGGCCTATGGCTCCATCTTCACAGGCGCTCAAC[TGG/CGG,T]
GGTATAAGCCATGGCTCCACCTAAACTTCTTCTCCAAAGCTTTACTGAAGGGGGTGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGTC

Reverse complement sequence

GACTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCACCCCCTTCAGTAAAGCTTTGGAGAAGAAGTTTAGGTGGAGCCATGGCTTATACC[CCA/CCG,A]
GTTGAGCGCCTGTGAAGATGGAGCCATAGGCCTGAAGTGCCTTTGTAATAATGTAAATATTATCGATATAATAAAGATGTGTCTTTTATATCATGTTTGT

Allele Frequencies:

Populations Population SizeFrequency of CGG(primary allele) Frequency of TGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 37.50% 0.17% 0.15% T: 0.42%
All Indica  2759 96.10% 2.80% 0.22% 0.14% T: 0.72%
All Japonica  1512 1.70% 98.30% 0.07% 0.00% NA
Aus  269 75.10% 24.90% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 96.80% 2.80% 0.22% 0.22% NA
Indica III  913 95.40% 2.50% 0.22% 0.11% T: 1.75%
Indica Intermediate  786 93.90% 5.10% 0.25% 0.25% T: 0.51%
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.40% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 0.00% 1.04% NA
Intermediate  90 43.30% 53.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214173791 TGG -> CGG LOC_Os02g24470.1 upstream_gene_variant ; 2324.0bp to feature; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> CGG LOC_Os02g24480.1 upstream_gene_variant ; 4782.0bp to feature; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> CGG LOC_Os02g24430.2 downstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> CGG LOC_Os02g24460.1 intron_variant ; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> T LOC_Os02g24470.1 upstream_gene_variant ; 2323.0bp to feature; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> T LOC_Os02g24480.1 upstream_gene_variant ; 4781.0bp to feature; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> T LOC_Os02g24430.2 downstream_gene_variant ; 2010.0bp to feature; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> T LOC_Os02g24460.1 intron_variant ; MODIFIER silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0214173791 TGG -> DEL N N silent_mutation Average:56.29; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214173791 NA 3.19E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791 5.65E-07 2.19E-06 mr1622_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791 NA 1.45E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791 NA 2.72E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214173791 NA 1.59E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251