Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214006862:

Variant ID: vg0214006862 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14006862
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGGAAAAAGTTTTTAAATCCTCTCCTAAGCCGTTGGGCTGATTTCAGCCCAACATCTCTCTCCCTCGCGCGCGTGCTGTGCAGCCCAAGTCGGCCCA[T/G]
CCGAGCTCCTCCTCTTTCTTTCTTTGCTTTGTTTTCAGCCAGCCCAAGACGAAAAGTCTAATTCTCCTCCCTGCTACAGTGTCGTCTTCAAGCTTGGACA

Reverse complement sequence

TGTCCAAGCTTGAAGACGACACTGTAGCAGGGAGGAGAATTAGACTTTTCGTCTTGGGCTGGCTGAAAACAAAGCAAAGAAAGAAAGAGGAGGAGCTCGG[A/C]
TGGGCCGACTTGGGCTGCACAGCACGCGCGCGAGGGAGAGAGATGTTGGGCTGAAATCAGCCCAACGGCTTAGGAGAGGATTTAAAAACTTTTTCCAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.60% 0.00% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214006862 T -> G LOC_Os02g24170.1 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:97.693; most accessible tissue: Zhenshan97 flower, score: 99.594 N N N N
vg0214006862 T -> G LOC_Os02g24190.1 upstream_gene_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:97.693; most accessible tissue: Zhenshan97 flower, score: 99.594 N N N N
vg0214006862 T -> G LOC_Os02g24190.2 upstream_gene_variant ; 4354.0bp to feature; MODIFIER silent_mutation Average:97.693; most accessible tissue: Zhenshan97 flower, score: 99.594 N N N N
vg0214006862 T -> G LOC_Os02g24190.3 upstream_gene_variant ; 4354.0bp to feature; MODIFIER silent_mutation Average:97.693; most accessible tissue: Zhenshan97 flower, score: 99.594 N N N N
vg0214006862 T -> G LOC_Os02g24170-LOC_Os02g24190 intergenic_region ; MODIFIER silent_mutation Average:97.693; most accessible tissue: Zhenshan97 flower, score: 99.594 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0214006862 T G 0.03 0.02 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214006862 NA 6.32E-74 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.48E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.17E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.01E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 5.82E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 4.63E-86 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 4.70E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.21E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 6.71E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 3.18E-27 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.17E-40 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 4.94E-107 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.03E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 3.97E-39 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 4.20E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 3.34E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.25E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 1.24E-14 mr1579_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 3.01E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214006862 NA 4.07E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251