\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0213899397:

Variant ID: vg0213899397 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 13899397
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTCTTCTTCCGGCTGCAGCAACTCGAATGAGGATTCAGCAGTTGAGTCGGGTTCCGACTCCACATGCAGAGGATCCTCATGGATAATCTCGACCTCCG[A/G]
GATGGCTCCGCTTCGGCCAAAAGAATCGTTCTCTAAGATCAGATCTAAGAGTTCTCTTCCCTCGTCGGTTGTCTTCTGTGCGAACGATCCTCTGGCGGAA

Reverse complement sequence

TTCCGCCAGAGGATCGTTCGCACAGAAGACAACCGACGAGGGAAGAGAACTCTTAGATCTGATCTTAGAGAACGATTCTTTTGGCCGAAGCGGAGCCATC[T/C]
CGGAGGTCGAGATTATCCATGAGGATCCTCTGCATGTGGAGTCGGAACCCGACTCAACTGCTGAATCCTCATTCGAGTTGCTGCAGCCGGAAGAAGAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 22.70% 2.37% 8.17% NA
All Indica  2759 99.40% 0.30% 0.07% 0.18% NA
All Japonica  1512 4.00% 64.40% 6.94% 24.74% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.40% 0.00% 0.65% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 99.00% 0.60% 0.25% 0.13% NA
Temperate Japonica  767 1.00% 94.10% 0.78% 4.04% NA
Tropical Japonica  504 7.70% 17.10% 17.66% 57.54% NA
Japonica Intermediate  241 5.40% 68.50% 4.15% 21.99% NA
VI/Aromatic  96 25.00% 72.90% 2.08% 0.00% NA
Intermediate  90 65.60% 23.30% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0213899397 A -> G LOC_Os02g23970.1 missense_variant ; p.Ser244Pro; MODERATE nonsynonymous_codon ; S244P Average:44.254; most accessible tissue: Zhenshan97 young leaf, score: 63.653 unknown unknown TOLERATED 1.00
vg0213899397 A -> DEL LOC_Os02g23970.1 N frameshift_variant Average:44.254; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0213899397 NA 2.59E-57 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 5.73E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 4.20E-45 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 3.31E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 7.15E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 7.73E-18 mr1228 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 3.79E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 2.92E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.76E-85 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 2.58E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 6.73E-75 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.16E-25 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 6.49E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 6.87E-41 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.16E-36 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 2.62E-28 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 3.39E-108 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 5.24E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.23E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 7.66E-40 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.04E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 7.95E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 5.85E-40 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.32E-49 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 7.92E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.75E-75 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.40E-34 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 4.37E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 3.31E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 1.43E-31 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 8.83E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 5.41E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 3.41E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213899397 NA 7.29E-149 mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251