\
| Variant ID: vg0213593475 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 13593475 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAGACCAACAAGCAGAGCAACGTTCCCGGTGAGACTTCAGCTAGTAGGAACTAAAGGGACAAGTCAGTCAGGTTTGAATGATGGAAGCAACAATAGTTC[C/T]
AGTCAAGACCTCTACTTTTCAGGTCTAAAAGGCAGTTCTAATCAGCAGCAGTCTACAATGGTTTGATTTTGTAGTACTTCTCATTGTACATATATGTTTA
TAAACATATATGTACAATGAGAAGTACTACAAAATCAAACCATTGTAGACTGCTGCTGATTAGAACTGCCTTTTAGACCTGAAAAGTAGAGGTCTTGACT[G/A]
GAACTATTGTTGCTTCCATCATTCAAACCTGACTGACTTGTCCCTTTAGTTCCTACTAGCTGAAGTCTCACCGGGAACGTTGCTCTGCTTGTTGGTCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 0.70% | 1.49% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0213593475 | C -> T | LOC_Os02g22800.1 | upstream_gene_variant ; 4620.0bp to feature; MODIFIER | N | Average:30.178; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0213593475 | C -> T | LOC_Os02g22810.1 | downstream_gene_variant ; 321.0bp to feature; MODIFIER | N | Average:30.178; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0213593475 | C -> T | LOC_Os02g22810-LOC_Os02g22820 | intergenic_region ; MODIFIER | N | Average:30.178; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0213593475 | NA | 6.43E-06 | mr1036 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213593475 | 6.23E-06 | 1.52E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213593475 | 6.60E-06 | 6.59E-06 | mr1306 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213593475 | NA | 9.53E-06 | mr1617 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213593475 | 6.95E-06 | 2.05E-08 | mr1659 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213593475 | NA | 2.40E-08 | mr1806 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |