\
| Variant ID: vg0213591886 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 13591886 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATGGCTAATCAAACTCAGACAGTGGAAGAGTTGTTACAACAGATGCGACGTTGGTACCAAATATACCAGATGCAACAGATGCAACGACAATGTCAGGAG[T/C]
CACGTCAATGTCACCCACCGCCGGTGCGAGATCAGATGCCAGCCCGGAACCCGAATCAGAGTCAGAGTCAGGAGTTCCCAATATCGGCACCGAAGACCCA
TGGGTCTTCGGTGCCGATATTGGGAACTCCTGACTCTGACTCTGATTCGGGTTCCGGGCTGGCATCTGATCTCGCACCGGCGGTGGGTGACATTGACGTG[A/G]
CTCCTGACATTGTCGTTGCATCTGTTGCATCTGGTATATTTGGTACCAACGTCGCATCTGTTGTAACAACTCTTCCACTGTCTGAGTTTGATTAGCCATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 1.20% | 3.85% | 3.79% | NA |
| All Indica | 2759 | 86.60% | 1.70% | 6.05% | 5.69% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.20% | 0.46% | NA |
| Aus | 269 | 90.30% | 3.30% | 4.09% | 2.23% | NA |
| Indica I | 595 | 83.70% | 1.80% | 7.06% | 7.39% | NA |
| Indica II | 465 | 83.20% | 0.60% | 4.95% | 11.18% | NA |
| Indica III | 913 | 87.20% | 2.80% | 7.12% | 2.85% | NA |
| Indica Intermediate | 786 | 89.90% | 0.90% | 4.71% | 4.45% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 1.10% | 1.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0213591886 | T -> DEL | LOC_Os02g22810.1 | N | frameshift_variant | Average:10.24; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0213591886 | T -> C | LOC_Os02g22810.1 | missense_variant ; p.Ser34Pro; MODERATE | nonsynonymous_codon ; S34P | Average:10.24; most accessible tissue: Minghui63 panicle, score: 16.27 | unknown | unknown | TOLERATED | 0.27 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0213591886 | NA | 1.39E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213591886 | NA | 2.22E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213591886 | 2.50E-06 | NA | mr1308_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213591886 | NA | 9.10E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213591886 | NA | 9.60E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213591886 | 3.38E-07 | NA | mr1853_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213591886 | 1.10E-06 | 1.10E-06 | mr1853_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |