\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0213449877:

Variant ID: vg0213449877 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 13449877
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGCCTCAGGGGCCTGCGACCCGAAAGGGAAGCGAAAGGTGTCCGAATCTCGGCCGCGTTCTCCCCCGCGCATAGGGCGCGCTAAGCGAACGGCGGACC[A/G]
TCCACCAGCGGGCCACAAACGCCCCGCCACGTCCGAGGCTGGACGGAAGAAGAAGCGGCTCCGGAAGATAGGGCAAACGGAGCCGTGCCGGGGGAGTTTC

Reverse complement sequence

GAAACTCCCCCGGCACGGCTCCGTTTGCCCTATCTTCCGGAGCCGCTTCTTCTTCCGTCCAGCCTCGGACGTGGCGGGGCGTTTGTGGCCCGCTGGTGGA[T/C]
GGTCCGCCGTTCGCTTAGCGCGCCCTATGCGCGGGGGAGAACGCGGCCGAGATTCGGACACCTTTCGCTTCCCTTTCGGGTCGCAGGCCCCTGAGGCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 41.30% 6.39% 0.00% NA
All Indica  2759 77.70% 12.40% 9.93% 0.00% NA
All Japonica  1512 1.20% 98.50% 0.33% 0.00% NA
Aus  269 93.30% 0.40% 6.32% 0.00% NA
Indica I  595 85.70% 0.80% 13.45% 0.00% NA
Indica II  465 63.90% 24.30% 11.83% 0.00% NA
Indica III  913 75.90% 17.20% 6.90% 0.00% NA
Indica Intermediate  786 81.80% 8.50% 9.67% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.00% 0.40% 0.00% NA
Japonica Intermediate  241 1.20% 97.50% 1.24% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 38.90% 54.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0213449877 A -> G LOC_Os02g22560.1 upstream_gene_variant ; 1080.0bp to feature; MODIFIER silent_mutation Average:75.497; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0213449877 A -> G LOC_Os02g22540.1 downstream_gene_variant ; 3469.0bp to feature; MODIFIER silent_mutation Average:75.497; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0213449877 A -> G LOC_Os02g22550.1 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:75.497; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0213449877 A -> G LOC_Os02g22570.1 downstream_gene_variant ; 3777.0bp to feature; MODIFIER silent_mutation Average:75.497; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0213449877 A -> G LOC_Os02g22550-LOC_Os02g22560 intergenic_region ; MODIFIER silent_mutation Average:75.497; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0213449877 A G 0.01 0.02 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0213449877 NA 1.06E-32 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.72E-32 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 5.47E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 2.27E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 3.27E-29 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 5.85E-31 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 7.22E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.01E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 3.85E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 2.57E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 2.48E-23 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 8.94E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.13E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 3.95E-34 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 9.10E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 3.68E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.60E-81 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 4.29E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.71E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.28E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.91E-33 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 3.25E-108 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.34E-09 mr1050_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 2.09E-28 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.64E-39 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 8.37E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.82E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.09E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 4.43E-39 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.31E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 1.77E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213449877 NA 6.80E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251