\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0213442655:

Variant ID: vg0213442655 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 13442655
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATGCATAGATCATTTTGCATGAGAGCGAATAAAGAAGACAGACTCACATAACGATAAAATAGTGGGGAAATTACATACATACTATAATAACACTAATA[A/G]
CATAAATACCTTGCAACCCATGTTCCTGAGCTAGGACCTAATGCATTTCACCCATCAAATCCCAACTGACTGACGAATAAATCTCAATAGTTTTACTAAA

Reverse complement sequence

TTTAGTAAAACTATTGAGATTTATTCGTCAGTCAGTTGGGATTTGATGGGTGAAATGCATTAGGTCCTAGCTCAGGAACATGGGTTGCAAGGTATTTATG[T/C]
TATTAGTGTTATTATAGTATGTATGTAATTTCCCCACTATTTTATCGTTATGTGAGTCTGTCTTCTTTATTCGCTCTCATGCAAAATGATCTATGCATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.80% 0.10% 19.13% 41.96% NA
All Indica  2759 5.30% 0.00% 27.18% 67.52% NA
All Japonica  1512 98.40% 0.00% 0.20% 1.39% NA
Aus  269 21.60% 1.90% 50.56% 26.02% NA
Indica I  595 5.90% 0.00% 15.80% 78.32% NA
Indica II  465 4.70% 0.00% 23.87% 71.40% NA
Indica III  913 3.90% 0.00% 36.80% 59.26% NA
Indica Intermediate  786 6.70% 0.00% 26.59% 66.67% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 97.60% 0.00% 0.60% 1.79% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 92.70% 0.00% 1.04% 6.25% NA
Intermediate  90 58.90% 0.00% 15.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0213442655 A -> G LOC_Os02g22520.1 upstream_gene_variant ; 1411.0bp to feature; MODIFIER silent_mutation Average:5.623; most accessible tissue: Callus, score: 7.992 N N N N
vg0213442655 A -> G LOC_Os02g22530.1 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:5.623; most accessible tissue: Callus, score: 7.992 N N N N
vg0213442655 A -> G LOC_Os02g22540.1 upstream_gene_variant ; 2485.0bp to feature; MODIFIER silent_mutation Average:5.623; most accessible tissue: Callus, score: 7.992 N N N N
vg0213442655 A -> G LOC_Os02g22530-LOC_Os02g22540 intergenic_region ; MODIFIER silent_mutation Average:5.623; most accessible tissue: Callus, score: 7.992 N N N N
vg0213442655 A -> DEL N N silent_mutation Average:5.623; most accessible tissue: Callus, score: 7.992 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0213442655 NA 2.18E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 5.38E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 1.13E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 5.27E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 4.13E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 5.70E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 9.92E-28 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 5.87E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 5.12E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 6.88E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 5.30E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 1.86E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 3.50E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 2.34E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 2.00E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 1.90E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 6.27E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 1.45E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 2.84E-07 mr1227_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 8.57E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 6.06E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655 NA 9.93E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251