Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0213442655:

Variant ID: vg0213442655 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 13442655
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATGCATAGATCATTTTGCATGAGAGCGAATAAAGAAGACAGACTCACATAACGATAAAATAGTGGGGAAATTACATACATACTATAATAACACTAATA[A/G]
CATAAATACCTTGCAACCCATGTTCCTGAGCTAGGACCTAATGCATTTCACCCATCAAATCCCAACTGACTGACGAATAAATCTCAATAGTTTTACTAAA

Reverse complement sequence

TTTAGTAAAACTATTGAGATTTATTCGTCAGTCAGTTGGGATTTGATGGGTGAAATGCATTAGGTCCTAGCTCAGGAACATGGGTTGCAAGGTATTTATG[T/C]
TATTAGTGTTATTATAGTATGTATGTAATTTCCCCACTATTTTATCGTTATGTGAGTCTGTCTTCTTTATTCGCTCTCATGCAAAATGATCTATGCATAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.80%	0.10%	19.13%	41.96%	NA
All Indica	2759	5.30%	0.00%	27.18%	67.52%	NA
All Japonica	1512	98.40%	0.00%	0.20%	1.39%	NA
Aus	269	21.60%	1.90%	50.56%	26.02%	NA
Indica I	595	5.90%	0.00%	15.80%	78.32%	NA
Indica II	465	4.70%	0.00%	23.87%	71.40%	NA
Indica III	913	3.90%	0.00%	36.80%	59.26%	NA
Indica Intermediate	786	6.70%	0.00%	26.59%	66.67%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	97.60%	0.00%	0.60%	1.79%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	92.70%	0.00%	1.04%	6.25%	NA
Intermediate	90	58.90%	0.00%	15.56%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0213442655	A -> G	LOC_Os02g22520.1	upstream_gene_variant ; 1411.0bp to feature; MODIFIER	silent_mutation	Average:5.623; most accessible tissue: Callus, score: 7.992	N	N	N	N
vg0213442655	A -> G	LOC_Os02g22530.1	upstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:5.623; most accessible tissue: Callus, score: 7.992	N	N	N	N
vg0213442655	A -> G	LOC_Os02g22540.1	upstream_gene_variant ; 2485.0bp to feature; MODIFIER	silent_mutation	Average:5.623; most accessible tissue: Callus, score: 7.992	N	N	N	N
vg0213442655	A -> G	LOC_Os02g22530-LOC_Os02g22540	intergenic_region ; MODIFIER	silent_mutation	Average:5.623; most accessible tissue: Callus, score: 7.992	N	N	N	N
vg0213442655	A -> DEL	N	N	silent_mutation	Average:5.623; most accessible tissue: Callus, score: 7.992	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0213442655	NA	2.18E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	5.38E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	1.13E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	5.27E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	4.13E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	5.70E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	9.92E-28	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	5.87E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	5.12E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	6.88E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	5.30E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	1.86E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	3.50E-26	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	2.34E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	2.00E-12	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	1.90E-16	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	6.27E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	1.45E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	2.84E-07	mr1227_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	8.57E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	6.06E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213442655	NA	9.93E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251