\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0213396747:

Variant ID: vg0213396747 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 13396747
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCTTCGGGCAAGGGCTATAACACTGTCGCAGTAAGGCACCGTTTGGTATAGCTCCAGCTTCTATCTCTCAACTCCAAACTCTAACTCCAATGGAAGC[C/T]
AGCTCCTCTAAAAGATGTAGGTGCTCTGAAAGTATTTGGCTAACTTACTCAGCTCTAGAAATCCTGCAAGAGACAATACTACCCTTCTGTTTTTTTCACT

Reverse complement sequence

AGTGAAAAAAACAGAAGGGTAGTATTGTCTCTTGCAGGATTTCTAGAGCTGAGTAAGTTAGCCAAATACTTTCAGAGCACCTACATCTTTTAGAGGAGCT[G/A]
GCTTCCATTGGAGTTAGAGTTTGGAGTTGAGAGATAGAAGCTGGAGCTATACCAAACGGTGCCTTACTGCGACAGTGTTATAGCCCTTGCCCGAAGCGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.20% 1.31% 0.00% NA
All Indica  2759 85.80% 12.10% 2.07% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 97.30% 0.00% 2.69% 0.00% NA
Indica II  465 71.60% 24.90% 3.44% 0.00% NA
Indica III  913 81.30% 17.60% 1.10% 0.00% NA
Indica Intermediate  786 90.70% 7.40% 1.91% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0213396747 C -> T LOC_Os02g22420.1 upstream_gene_variant ; 3383.0bp to feature; MODIFIER silent_mutation Average:66.9; most accessible tissue: Callus, score: 86.295 N N N N
vg0213396747 C -> T LOC_Os02g22430.1 upstream_gene_variant ; 2103.0bp to feature; MODIFIER silent_mutation Average:66.9; most accessible tissue: Callus, score: 86.295 N N N N
vg0213396747 C -> T LOC_Os02g22430-LOC_Os02g22440 intergenic_region ; MODIFIER silent_mutation Average:66.9; most accessible tissue: Callus, score: 86.295 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0213396747 NA 2.06E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 6.08E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.40E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 2.02E-06 NA mr1129 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 2.21E-06 1.51E-08 mr1129 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.14E-09 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.25E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 6.47E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 8.35E-06 NA mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.19E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 9.92E-09 3.24E-18 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 1.67E-08 2.21E-19 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 4.20E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 8.52E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 2.83E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 4.69E-07 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 3.14E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.28E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.73E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 6.68E-06 NA mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 8.90E-09 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 5.30E-06 NA mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 4.15E-06 6.86E-12 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.44E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 8.34E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.55E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.83E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 7.10E-10 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 1.81E-09 7.61E-16 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 1.51E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 2.00E-06 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 1.84E-06 4.97E-12 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213396747 NA 2.78E-08 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251