\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0213232689:

Variant ID: vg0213232689 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 13232689
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CTATCTATATTATCTAATTCATGTTTTTTTTTCTGCGTTCCATCCAAACGATTATTTCTACCGTTTTCTTGTGTTTTTCTATCCATAGGAATTAAGATGT[C/A]
AACACACTTGAATCCTACGTTTTTCTTATCATTTTGAAAGTCCTACGAACGAAAGGAGCCTTATTATTCAAAATTTTTGAACTGGCCGGATCATTTTCTC

Reverse complement sequence

GAGAAAATGATCCGGCCAGTTCAAAAATTTTGAATAATAAGGCTCCTTTCGTTCGTAGGACTTTCAAAATGATAAGAAAAACGTAGGATTCAAGTGTGTT[G/T]
ACATCTTAATTCCTATGGATAGAAAAACACAAGAAAACGGTAGAAATAATCGTTTGGATGGAACGCAGAAAAAAAAACATGAATTAGATAATATAGATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.20% 0.66% 0.00% NA
All Indica  2759 96.80% 2.10% 1.05% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 87.70% 8.90% 3.36% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.60% 1.02% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0213232689 C -> A LOC_Os02g22200.1 downstream_gene_variant ; 937.0bp to feature; MODIFIER silent_mutation Average:76.612; most accessible tissue: Callus, score: 97.328 N N N N
vg0213232689 C -> A LOC_Os02g22210.1 downstream_gene_variant ; 1833.0bp to feature; MODIFIER silent_mutation Average:76.612; most accessible tissue: Callus, score: 97.328 N N N N
vg0213232689 C -> A LOC_Os02g22200-LOC_Os02g22210 intergenic_region ; MODIFIER silent_mutation Average:76.612; most accessible tissue: Callus, score: 97.328 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0213232689 NA 4.43E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 NA 3.25E-11 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 NA 9.69E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 NA 5.37E-10 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 NA 5.73E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 NA 3.19E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 NA 1.88E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 8.37E-11 8.95E-22 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 2.22E-07 8.03E-11 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 8.64E-08 2.12E-14 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0213232689 NA 1.08E-11 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251