\
| Variant ID: vg0213232689 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 13232689 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )
CTATCTATATTATCTAATTCATGTTTTTTTTTCTGCGTTCCATCCAAACGATTATTTCTACCGTTTTCTTGTGTTTTTCTATCCATAGGAATTAAGATGT[C/A]
AACACACTTGAATCCTACGTTTTTCTTATCATTTTGAAAGTCCTACGAACGAAAGGAGCCTTATTATTCAAAATTTTTGAACTGGCCGGATCATTTTCTC
GAGAAAATGATCCGGCCAGTTCAAAAATTTTGAATAATAAGGCTCCTTTCGTTCGTAGGACTTTCAAAATGATAAGAAAAACGTAGGATTCAAGTGTGTT[G/T]
ACATCTTAATTCCTATGGATAGAAAAACACAAGAAAACGGTAGAAATAATCGTTTGGATGGAACGCAGAAAAAAAAACATGAATTAGATAATATAGATAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.20% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 2.10% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.70% | 8.90% | 3.36% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 0.60% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0213232689 | C -> A | LOC_Os02g22200.1 | downstream_gene_variant ; 937.0bp to feature; MODIFIER | silent_mutation | Average:76.612; most accessible tissue: Callus, score: 97.328 | N | N | N | N |
| vg0213232689 | C -> A | LOC_Os02g22210.1 | downstream_gene_variant ; 1833.0bp to feature; MODIFIER | silent_mutation | Average:76.612; most accessible tissue: Callus, score: 97.328 | N | N | N | N |
| vg0213232689 | C -> A | LOC_Os02g22200-LOC_Os02g22210 | intergenic_region ; MODIFIER | silent_mutation | Average:76.612; most accessible tissue: Callus, score: 97.328 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0213232689 | NA | 4.43E-09 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | NA | 3.25E-11 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | NA | 9.69E-06 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | NA | 5.37E-10 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | NA | 5.73E-08 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | NA | 3.19E-08 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | NA | 1.88E-08 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | 8.37E-11 | 8.95E-22 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | 2.22E-07 | 8.03E-11 | mr1897_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | 8.64E-08 | 2.12E-14 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0213232689 | NA | 1.08E-11 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |