Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212875961:

Variant ID: vg0212875961 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12875961
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAAAATGCCTATATTCTGGAATGGGGAAGTACATACAAGTTATCAATGTATAAAACTGTGATTGATCAAAGTAAATTAAATAAATTCATTTTCTAACA[G/T]
ATGGCATATTGAATTATGTGGACAACAAAGCATACATAAAAGGTAAATTTTGTTGTAGAACATCATGACTTTGTGATTTATCTTCTGGATAAAGCAAAAG

Reverse complement sequence

CTTTTGCTTTATCCAGAAGATAAATCACAAAGTCATGATGTTCTACAACAAAATTTACCTTTTATGTATGCTTTGTTGTCCACATAATTCAATATGCCAT[C/A]
TGTTAGAAAATGAATTTATTTAATTTACTTTGATCAATCACAGTTTTATACATTGATAACTTGTATGTACTTCCCCATTCCAGAATATAGGCATTTTTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 16.60% 4.57% 0.00% NA
All Indica  2759 64.70% 27.90% 7.32% 0.00% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 97.80% 0.00% 2.23% 0.00% NA
Indica I  595 71.10% 12.60% 16.30% 0.00% NA
Indica II  465 61.90% 30.50% 7.53% 0.00% NA
Indica III  913 54.40% 44.40% 1.20% 0.00% NA
Indica Intermediate  786 73.50% 19.00% 7.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.60% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 7.80% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212875961 G -> T LOC_Os02g21660.1 downstream_gene_variant ; 3489.0bp to feature; MODIFIER silent_mutation Average:48.457; most accessible tissue: Callus, score: 84.265 N N N N
vg0212875961 G -> T LOC_Os02g21670.1 downstream_gene_variant ; 931.0bp to feature; MODIFIER silent_mutation Average:48.457; most accessible tissue: Callus, score: 84.265 N N N N
vg0212875961 G -> T LOC_Os02g21660.2 downstream_gene_variant ; 3490.0bp to feature; MODIFIER silent_mutation Average:48.457; most accessible tissue: Callus, score: 84.265 N N N N
vg0212875961 G -> T LOC_Os02g21660.3 downstream_gene_variant ; 3490.0bp to feature; MODIFIER silent_mutation Average:48.457; most accessible tissue: Callus, score: 84.265 N N N N
vg0212875961 G -> T LOC_Os02g21660-LOC_Os02g21670 intergenic_region ; MODIFIER silent_mutation Average:48.457; most accessible tissue: Callus, score: 84.265 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212875961 2.45E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 5.85E-06 9.28E-12 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 7.27E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 9.03E-06 5.42E-11 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 4.53E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 6.94E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 2.12E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 5.07E-07 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 2.62E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 1.86E-18 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 2.96E-07 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 5.25E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 3.69E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 1.02E-11 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 9.84E-06 1.58E-11 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 6.86E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 2.06E-06 NA mr1253_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 1.18E-06 2.51E-08 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 3.34E-09 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 1.55E-11 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 1.49E-11 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 5.62E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 1.41E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 3.23E-08 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 5.44E-10 1.04E-20 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 6.28E-09 2.36E-23 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 5.17E-07 2.27E-10 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 3.57E-07 3.58E-13 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 3.24E-07 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 2.22E-07 1.25E-16 mr1914_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212875961 NA 1.01E-12 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251