\
| Variant ID: vg0212840859 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12840859 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACAAAGTTATTGCAACTCTCACTATCGATTATAGTACGACATGCTCTATCCTTAACCATAAACTTTGTTTCAAATAATTCGTGATACTGCCATTGCTCCG[C/A]
TTTCTCCATTTGAGAACTTAGCACTTGTTGCACCCAAGTACTTTCATCACGTGCACCTTGTTGGTATCGCTGATTTTGAGCGCCACTCATACCTGTCATT
AATGACAGGTATGAGTGGCGCTCAAAATCAGCGATACCAACAAGGTGCACGTGATGAAAGTACTTGGGTGCAACAAGTGCTAAGTTCTCAAATGGAGAAA[G/T]
CGGAGCAATGGCAGTATCACGAATTATTTGAAACAAAGTTTATGGTTAAGGATAGAGCATGTCGTACTATAATCGATAGTGAGAGTTGCAATAACTTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 4.40% | 3.43% | 0.00% | NA |
| All Indica | 2759 | 90.80% | 6.40% | 2.79% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.00% | 11.90% | 30.11% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 89.70% | 5.20% | 5.16% | 0.00% | NA |
| Indica III | 913 | 85.50% | 11.80% | 2.63% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 5.60% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212840859 | C -> A | LOC_Os02g21620.1 | missense_variant ; p.Ala229Ser; MODERATE | nonsynonymous_codon ; A229S | Average:5.194; most accessible tissue: Callus, score: 9.491 | benign |
1.303 |
TOLERATED | 0.41 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212840859 | 3.30E-06 | 3.30E-06 | mr1562 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840859 | NA | 7.84E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840859 | NA | 2.50E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840859 | 1.01E-06 | NA | mr1208_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840859 | NA | 7.90E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840859 | NA | 2.92E-08 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |