Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212837159:

Variant ID: vg0212837159 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12837159
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGGCTATAAAAGGAGCTCTCATCCTCACTTCACTCACACACCTCAAGCAAGAGCTCTCTCGTATTCTTTCAAGTTAGTTTAGTATTCTTAAGCTAGTG[G/C]
AATAGGAATAGAGTAGAAATCGCGAGTCCGAAAGCCTTCGGAAGAGTTCAGGTATGGCTCTAGTAGCTTTCCTTTCCTCTTTTGTAACCTTTGTACTTTA

Reverse complement sequence

TAAAGTACAAAGGTTACAAAAGAGGAAAGGAAAGCTACTAGAGCCATACCTGAACTCTTCCGAAGGCTTTCGGACTCGCGATTTCTACTCTATTCCTATT[C/G]
CACTAGCTTAAGAATACTAAACTAACTTGAAAGAATACGAGAGAGCTCTTGCTTGAGGTGTGTGAGTGAAGTGAGGATGAGAGCTCCTTTTATAGCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.20%	0.20%	0.76%	60.85%	NA
All Indica	2759	6.20%	0.40%	0.98%	92.42%	NA
All Japonica	1512	98.30%	0.00%	0.07%	1.65%	NA
Aus	269	3.00%	0.00%	1.49%	95.54%	NA
Indica I	595	9.40%	0.00%	1.01%	89.58%	NA
Indica II	465	7.70%	0.20%	1.29%	90.75%	NA
Indica III	913	2.50%	0.70%	0.66%	96.17%	NA
Indica Intermediate	786	7.10%	0.50%	1.15%	91.22%	NA
Temperate Japonica	767	99.00%	0.00%	0.00%	1.04%	NA
Tropical Japonica	504	97.60%	0.00%	0.00%	2.38%	NA
Japonica Intermediate	241	97.50%	0.00%	0.41%	2.07%	NA
VI/Aromatic	96	87.50%	0.00%	4.17%	8.33%	NA
Intermediate	90	60.00%	0.00%	0.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212837159	G -> DEL	N	N	silent_mutation	Average:27.153; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0212837159	G -> C	LOC_Os02g21600.1	downstream_gene_variant ; 4088.0bp to feature; MODIFIER	silent_mutation	Average:27.153; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0212837159	G -> C	LOC_Os02g21610.1	downstream_gene_variant ; 2013.0bp to feature; MODIFIER	silent_mutation	Average:27.153; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0212837159	G -> C	LOC_Os02g21620.1	downstream_gene_variant ; 2016.0bp to feature; MODIFIER	silent_mutation	Average:27.153; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0212837159	G -> C	LOC_Os02g21610-LOC_Os02g21620	intergenic_region ; MODIFIER	silent_mutation	Average:27.153; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212837159	NA	1.98E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	1.88E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	1.93E-06	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	3.44E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	2.33E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	1.81E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	3.08E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	8.99E-06	8.99E-06	mr1289_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	6.65E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	NA	1.42E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212837159	1.38E-06	5.23E-07	mr1921_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251