Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212736616:

Variant ID: vg0212736616 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12736616
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AATGCAGAAATTGAATGAGAGAGATAGACTTAAAGGAAAGTTACCAAGAGGTTGAAGTTCTTGATAAATTTCCTCCAAAATCTGATTGTCCATTCCATAG[G/A]
AATTTCAAAGGATTGGATAGGATTCAATCCTTTGTTTCAAAGGGCTTCTTAGGAAATTTTTCAATAAGATTGAAATCCTCCAAAATTCCTATGTTTTTCC

Reverse complement sequence

GGAAAAACATAGGAATTTTGGAGGATTTCAATCTTATTGAAAAATTTCCTAAGAAGCCCTTTGAAACAAAGGATTGAATCCTATCCAATCCTTTGAAATT[C/T]
CTATGGAATGGACAATCAGATTTTGGAGGAAATTTATCAAGAACTTCAACCTCTTGGTAACTTTCCTTTAAGTCTATCTCTCTCATTCAATTTCTGCATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	32.70%	10.05%	5.95%	NA
All Indica	2759	72.70%	2.40%	15.30%	9.57%	NA
All Japonica	1512	9.90%	89.00%	1.12%	0.00%	NA
Aus	269	83.60%	0.40%	10.78%	5.20%	NA
Indica I	595	78.20%	3.40%	12.94%	5.55%	NA
Indica II	465	71.20%	3.90%	18.28%	6.67%	NA
Indica III	913	69.70%	0.70%	16.43%	13.25%	NA
Indica Intermediate	786	73.20%	2.80%	13.99%	10.05%	NA
Temperate Japonica	767	3.40%	96.10%	0.52%	0.00%	NA
Tropical Japonica	504	17.50%	80.60%	1.98%	0.00%	NA
Japonica Intermediate	241	14.50%	84.20%	1.24%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	45.60%	44.40%	6.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212736616	G -> A	LOC_Os02g21460.1	upstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:31.675; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0212736616	G -> A	LOC_Os02g21470.1	upstream_gene_variant ; 434.0bp to feature; MODIFIER	silent_mutation	Average:31.675; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0212736616	G -> A	LOC_Os02g21460.2	upstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:31.675; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0212736616	G -> A	LOC_Os02g21480.1	downstream_gene_variant ; 1192.0bp to feature; MODIFIER	silent_mutation	Average:31.675; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0212736616	G -> A	LOC_Os02g21490.1	downstream_gene_variant ; 4987.0bp to feature; MODIFIER	silent_mutation	Average:31.675; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0212736616	G -> A	LOC_Os02g21470-LOC_Os02g21480	intergenic_region ; MODIFIER	silent_mutation	Average:31.675; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0212736616	G -> DEL	N	N	silent_mutation	Average:31.675; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212736616	NA	4.78E-73	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	1.13E-56	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	9.75E-32	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	7.61E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	6.72E-08	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	1.37E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	1.23E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	3.11E-50	mr1563	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	1.24E-34	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	8.30E-32	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	2.12E-70	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	3.11E-20	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	4.13E-79	mr1563_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	2.63E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212736616	NA	1.08E-61	mr1733_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251