\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212591710:

Variant ID: vg0212591710 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 12591710
Reference Allele: TCTCAlternative Allele: CCTC,T
Primary Allele: TCTCSecondary Allele: CCTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACAATGGAAATGCAGAACAATAGGAAAACTTGGCAAGCAAGAAGAAAAGGATTAGCAGCCGCGTGGCTTCAGACGAGAAGCCTATAAAACCGCAGCAA[TCTC/CCTC,T]
CTCCTCAACGAATCTTCCCACTTGCCCTCTTCTTCTTCCCACCATTCCCAATCCCATCCAAAAGTTTCCAGAAACTCATCCTCCTCCTCCTCCTCCCCCT

Reverse complement sequence

AGGGGGAGGAGGAGGAGGAGGATGAGTTTCTGGAAACTTTTGGATGGGATTGGGAATGGTGGGAAGAAGAAGAGGGCAAGTGGGAAGATTCGTTGAGGAG[GAGA/GAGG,A]
TTGCTGCGGTTTTATAGGCTTCTCGTCTGAAGCCACGCGGCTGCTAATCCTTTTCTTCTTGCTTGCCAAGTTTTCCTATTGTTCTGCATTTCCATTGTTC

Allele Frequencies:

Populations Population SizeFrequency of TCTC(primary allele) Frequency of CCTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 9.80% 5.76% 0.00% NA
All Indica  2759 74.60% 16.30% 9.10% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.07% 0.00% NA
Aus  269 96.30% 0.00% 3.72% 0.00% NA
Indica I  595 69.60% 7.90% 22.52% 0.00% NA
Indica II  465 64.90% 25.80% 9.25% 0.00% NA
Indica III  913 77.00% 21.70% 1.31% 0.00% NA
Indica Intermediate  786 81.30% 10.80% 7.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 6.70% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212591710 TCTC -> CCTC LOC_Os02g21220.1 upstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0212591710 TCTC -> CCTC LOC_Os02g21230.1 upstream_gene_variant ; 3051.0bp to feature; MODIFIER silent_mutation Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0212591710 TCTC -> CCTC LOC_Os02g21190.2 downstream_gene_variant ; 3329.0bp to feature; MODIFIER silent_mutation Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0212591710 TCTC -> CCTC LOC_Os02g21190-LOC_Os02g21220 intergenic_region ; MODIFIER silent_mutation Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0212591710 TCTC -> T LOC_Os02g21220.1 upstream_gene_variant ; 121.0bp to feature; MODIFIER N Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0212591710 TCTC -> T LOC_Os02g21230.1 upstream_gene_variant ; 3050.0bp to feature; MODIFIER N Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0212591710 TCTC -> T LOC_Os02g21190.2 downstream_gene_variant ; 3330.0bp to feature; MODIFIER N Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0212591710 TCTC -> T LOC_Os02g21190-LOC_Os02g21220 intergenic_region ; MODIFIER N Average:74.293; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0212591710 TCTC CCTC 0.04 0.02 0.01 0.01 0.03 0.03
vg0212591710 TCTC T 0.45 0.3 0.28 0.23 0.29 0.26

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212591710 NA 1.17E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 8.55E-09 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 3.28E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 9.80E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 4.55E-08 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 3.52E-07 8.21E-23 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 4.55E-06 1.12E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 1.96E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 2.03E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 6.05E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 1.58E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 5.71E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 2.80E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 6.91E-08 6.37E-11 mr1317_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 4.74E-08 2.68E-18 mr1317_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 7.20E-06 NA mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 3.93E-06 7.93E-12 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 6.83E-11 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 2.61E-10 2.40E-25 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 2.12E-08 2.12E-28 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 4.94E-08 9.04E-12 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 1.14E-07 3.83E-15 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 2.79E-07 NA mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 8.13E-07 4.67E-18 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 6.72E-06 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212591710 NA 3.12E-14 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251