\
| Variant ID: vg0212395942 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12395942 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 227. )
CCCCATTCATGATGAGCATATTAGTCATCTAGCGTTGTCCTTAATCCACCTTTAACTAACACACTACTACAGAAAAGAAGATAGGTGTCGGTTGGGAACC[G/A]
GTCATAGGTGCTGAATTTTCCAACCGACATGTAGTGAGGTCTCAAATGTGTCAGTTTAAAAACCTACAAATAACAAAAAAAAAGGAAAAAAAAAGCTGGC
GCCAGCTTTTTTTTTCCTTTTTTTTTGTTATTTGTAGGTTTTTAAACTGACACATTTGAGACCTCACTACATGTCGGTTGGAAAATTCAGCACCTATGAC[C/T]
GGTTCCCAACCGACACCTATCTTCTTTTCTGTAGTAGTGTGTTAGTTAAAGGTGGATTAAGGACAACGCTAGATGACTAATATGCTCATCATGAATGGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 30.60% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 3.00% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 22.30% | 76.10% | 1.59% | 0.00% | NA |
| Aus | 269 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 6.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 4.20% | 95.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 52.20% | 44.20% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 81.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 37.80% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212395942 | G -> A | LOC_Os02g20950.1 | downstream_gene_variant ; 1699.0bp to feature; MODIFIER | silent_mutation | Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 | N | N | N | N |
| vg0212395942 | G -> A | LOC_Os02g20960.1 | downstream_gene_variant ; 267.0bp to feature; MODIFIER | silent_mutation | Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 | N | N | N | N |
| vg0212395942 | G -> A | LOC_Os02g20970.1 | downstream_gene_variant ; 2479.0bp to feature; MODIFIER | silent_mutation | Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 | N | N | N | N |
| vg0212395942 | G -> A | LOC_Os02g20950-LOC_Os02g20960 | intergenic_region ; MODIFIER | silent_mutation | Average:68.425; most accessible tissue: Minghui63 young leaf, score: 80.234 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212395942 | NA | 3.54E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 1.27E-08 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 3.31E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 2.45E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 1.87E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | 9.75E-07 | NA | mr1042_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 2.58E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 5.06E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 5.27E-09 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 2.43E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 6.05E-06 | mr1319_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 6.93E-08 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 6.32E-07 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 2.59E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 1.33E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | NA | 1.29E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | 5.39E-06 | 3.93E-10 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | 1.78E-09 | NA | mr1871_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212395942 | 1.09E-06 | 3.34E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |