\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212359529:

Variant ID: vg0212359529 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12359529
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACAACAGGTGATGAAATTTCATAGTCTAGCATCTAACTAAACAAAATATAAACTATGAATAAATTTATTATTGAGCAGTGGCATTATAACATATCTGCCC[C/T]
CTTCCCTAAAAAAGGGAAAATATGACACGAAGGGCCTATAACAGTGCATGCTTACTTCTAGTGATTACACAAAAGAATTAAACCGCAAGCACCACCATTA

Reverse complement sequence

TAATGGTGGTGCTTGCGGTTTAATTCTTTTGTGTAATCACTAGAAGTAAGCATGCACTGTTATAGGCCCTTCGTGTCATATTTTCCCTTTTTTAGGGAAG[G/A]
GGGCAGATATGTTATAATGCCACTGCTCAATAATAAATTTATTCATAGTTTATATTTTGTTTAGTTAGATGCTAGACTATGAAATTTCATCACCTGTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 17.30% 35.70% 4.70% NA
All Indica  2759 12.90% 23.80% 55.71% 7.54% NA
All Japonica  1512 98.30% 0.60% 0.86% 0.20% NA
Aus  269 2.20% 54.60% 40.15% 2.97% NA
Indica I  595 12.40% 10.10% 68.24% 9.24% NA
Indica II  465 6.00% 25.60% 54.19% 14.19% NA
Indica III  913 17.90% 32.60% 45.89% 3.61% NA
Indica Intermediate  786 11.70% 22.90% 58.52% 6.87% NA
Temperate Japonica  767 99.10% 0.10% 0.65% 0.13% NA
Tropical Japonica  504 97.40% 1.60% 0.99% 0.00% NA
Japonica Intermediate  241 97.90% 0.00% 1.24% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 58.90% 6.70% 31.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212359529 C -> T LOC_Os02g20900.1 downstream_gene_variant ; 4858.0bp to feature; MODIFIER silent_mutation Average:36.566; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0212359529 C -> T LOC_Os02g20920.1 downstream_gene_variant ; 1026.0bp to feature; MODIFIER silent_mutation Average:36.566; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0212359529 C -> T LOC_Os02g20900-LOC_Os02g20920 intergenic_region ; MODIFIER silent_mutation Average:36.566; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0212359529 C -> DEL N N silent_mutation Average:36.566; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212359529 NA 2.48E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 4.73E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 9.91E-06 1.69E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 1.06E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 1.60E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 3.18E-06 2.79E-06 mr1297 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 4.12E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 1.88E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 5.99E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 1.28E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 8.88E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 1.56E-06 1.35E-06 mr1433 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 1.05E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 2.26E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 7.68E-06 7.68E-06 mr1483 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 9.43E-07 9.43E-07 mr1485 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 2.07E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 2.91E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 2.49E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 3.92E-06 3.92E-06 mr1724 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 9.03E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 7.72E-06 7.72E-06 mr1774 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 4.39E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 4.39E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 1.19E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 1.64E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212359529 NA 3.44E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251