Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212316464:

Variant ID: vg0212316464 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12316464
Reference Allele: T	Alternative Allele: A,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCCGGTTTGCTGACTCTATCTTTGATGATGAACATTTCCTGGCAATAGGGGGAGACTTCAAGTACCAGAAAGAATGCCAGGAAATTGATTGGGATGCC[T/A,C]
AGGGTATTCTAGCCTCAGACCCACGTACTACTGAAACTGATCTTCAAGTTCAGAAAATTATACATTTGCAAAGACTTGCAAATAATCTACCAGATGTATT

Reverse complement sequence

AATACATCTGGTAGATTATTTGCAAGTCTTTGCAAATGTATAATTTTCTGAACTTGAAGATCAGTTTCAGTAGTACGTGGGTCTGAGGCTAGAATACCCT[A/T,G]
GGCATCCCAATCAATTTCCTGGCATTCTTTCTGGTACTTGAAGTCTCCCCCTATTGCCAGGAAATGTTCATCATCAAAGATAGAGTCAGCAAACCGGGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	7.00%	0.30%	0.00%	C: 0.02%
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	78.10%	21.20%	0.66%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	96.70%	3.10%	0.13%	0.00%	NA
Tropical Japonica	504	47.00%	51.40%	1.59%	0.00%	NA
Japonica Intermediate	241	83.80%	15.80%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	10.00%	4.44%	0.00%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212316464	T -> A	LOC_Os02g20844.1	upstream_gene_variant ; 3787.0bp to feature; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0212316464	T -> A	LOC_Os02g20844.2	upstream_gene_variant ; 3787.0bp to feature; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0212316464	T -> A	LOC_Os02g20830.1	downstream_gene_variant ; 4157.0bp to feature; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0212316464	T -> A	LOC_Os02g20840.1	intron_variant ; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0212316464	T -> C	LOC_Os02g20844.1	upstream_gene_variant ; 3787.0bp to feature; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0212316464	T -> C	LOC_Os02g20844.2	upstream_gene_variant ; 3787.0bp to feature; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0212316464	T -> C	LOC_Os02g20830.1	downstream_gene_variant ; 4157.0bp to feature; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N
vg0212316464	T -> C	LOC_Os02g20840.1	intron_variant ; MODIFIER	silent_mutation	Average:26.754; most accessible tissue: Minghui63 flag leaf, score: 40.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212316464	NA	2.37E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212316464	NA	2.60E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212316464	NA	3.68E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212316464	NA	2.86E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212316464	9.52E-06	3.56E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212316464	8.62E-07	2.77E-11	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212316464	3.93E-07	2.11E-09	mr1871_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251