\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212311200:

Variant ID: vg0212311200 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12311200
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTATTACCTGCATTTTTTCAAAACATTACAAAATATGAAGTATTACATTTCGCATTGAGATTACAACCTTAATATCATGTTTTTATTAATTTACCTCT[A/G]
TAAATTGATAATGTTAACCATGATTGTAGGGACATGGCAACAAAAAAGTTCGACGAACTCGCCCTCGATGGGACTAACTATCCCATCCGGGCTTCTAATA

Reverse complement sequence

TATTAGAAGCCCGGATGGGATAGTTAGTCCCATCGAGGGCGAGTTCGTCGAACTTTTTTGTTGCCATGTCCCTACAATCATGGTTAACATTATCAATTTA[T/C]
AGAGGTAAATTAATAAAAACATGATATTAAGGTTGTAATCTCAATGCGAAATGTAATACTTCATATTTTGTAATGTTTTGAAAAAATGCAGGTAATAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.50% 0.36% 0.00% NA
All Indica  2759 96.10% 3.40% 0.43% 0.00% NA
All Japonica  1512 1.90% 98.10% 0.00% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 97.10% 2.20% 0.67% 0.00% NA
Indica II  465 96.10% 3.20% 0.65% 0.00% NA
Indica III  913 97.00% 2.70% 0.22% 0.00% NA
Indica Intermediate  786 94.30% 5.30% 0.38% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 43.30% 52.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212311200 A -> G LOC_Os02g20820.1 upstream_gene_variant ; 4660.0bp to feature; MODIFIER silent_mutation Average:21.209; most accessible tissue: Minghui63 flag leaf, score: 30.104 N N N N
vg0212311200 A -> G LOC_Os02g20840.1 upstream_gene_variant ; 1386.0bp to feature; MODIFIER silent_mutation Average:21.209; most accessible tissue: Minghui63 flag leaf, score: 30.104 N N N N
vg0212311200 A -> G LOC_Os02g20830.1 intron_variant ; MODIFIER silent_mutation Average:21.209; most accessible tissue: Minghui63 flag leaf, score: 30.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212311200 NA 3.55E-26 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 2.21E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 7.15E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 3.49E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 2.44E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 1.75E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 1.40E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 5.91E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 4.05E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 2.13E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 1.01E-27 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 1.02E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 9.93E-40 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 2.60E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 3.07E-37 mr1944 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 1.58E-104 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 2.60E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 2.07E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 3.23E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 1.21E-31 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212311200 NA 6.70E-18 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251