\
| Variant ID: vg0212300877 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12300877 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGGGTACGCTGGTACGAGGATCTACATAATACGACATCAAGCAGGCAGAAAACAAAGATTATACTGGTTTAGGCCCCTTGATAGGTAATAGCCCTAATC[C/T]
AGTTGATATGGGATTATATGATGGAAACCACATATTACAAAGGGAATAGCGGAACTCGACGATACCGACGAGATCGTAGTCGAATTGATTCGACTAGATC
GATCTAGTCGAATCAATTCGACTACGATCTCGTCGGTATCGTCGAGTTCCGCTATTCCCTTTGTAATATGTGGTTTCCATCATATAATCCCATATCAACT[G/A]
GATTAGGGCTATTACCTATCAAGGGGCCTAAACCAGTATAATCTTTGTTTTCTGCCTGCTTGATGTCGTATTATGTAGATCCTCGTACCAGCGTACCCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.70% | 0.20% | 2.39% | 24.76% | NA |
| All Indica | 2759 | 56.50% | 0.30% | 3.84% | 39.36% | NA |
| All Japonica | 1512 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Aus | 269 | 78.80% | 0.00% | 2.23% | 18.96% | NA |
| Indica I | 595 | 55.00% | 0.00% | 6.39% | 38.66% | NA |
| Indica II | 465 | 57.00% | 0.60% | 3.44% | 38.92% | NA |
| Indica III | 913 | 50.70% | 0.70% | 2.52% | 46.11% | NA |
| Indica Intermediate | 786 | 64.00% | 0.00% | 3.69% | 32.32% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 1.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212300877 | C -> T | LOC_Os02g20820.1 | downstream_gene_variant ; 4961.0bp to feature; MODIFIER | silent_mutation | Average:21.402; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0212300877 | C -> T | LOC_Os02g20810-LOC_Os02g20820 | intergenic_region ; MODIFIER | silent_mutation | Average:21.402; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0212300877 | C -> DEL | N | N | silent_mutation | Average:21.402; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212300877 | 2.88E-07 | 7.07E-09 | mr1004 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212300877 | 1.50E-07 | 4.70E-08 | mr1005 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212300877 | 5.19E-09 | 9.39E-08 | mr1011 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212300877 | 7.30E-08 | 2.11E-07 | mr1012 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |