RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0212179937:

Variant ID: vg0212179937 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12179937
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

ACATAAAGGGCAGATTTAACATGTCAATAAAACATATAGAGCAAATGTAGTTAAATCAGATAAGATCAGCTGAAATCCCGATACTACCCTAATCGGCAAC[C/T]
AGAAGGCAGGTTAGAGATTGATATTCCAAGCACGACTTAATAGATCAAACTCAACTAATGCGGCATTAAGTATGAAAAGAAGAACAATATCTAGATAATC

Reverse complement sequence

GATTATCTAGATATTGTTCTTCTTTTCATACTTAATGCCGCATTAGTTGAGTTTGATCTATTAAGTCGTGCTTGGAATATCAATCTCTAACCTGCCTTCT[G/A]
GTTGCCGATTAGGGTAGTATCGGGATTTCAGCTGATCTTATCTGATTTAACTACATTTGCTCTATATGTTTTATTGACATGTTAAATCTGCCCTTTATGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	10.90%	3.79%	0.00%	NA
All Indica	2759	75.90%	17.80%	6.31%	0.00%	NA
All Japonica	1512	99.30%	0.60%	0.07%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	60.30%	25.90%	13.78%	0.00%	NA
Indica II	465	63.00%	29.20%	7.74%	0.00%	NA
Indica III	913	98.90%	0.50%	0.55%	0.00%	NA
Indica Intermediate	786	68.40%	25.10%	6.49%	0.00%	NA
Temperate Japonica	767	99.20%	0.70%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212179937	C -> T	LOC_Os02g20660.1	upstream_gene_variant ; 2040.0bp to feature; MODIFIER	silent_mutation	Average:36.206; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0212179937	C -> T	LOC_Os02g20670.1	upstream_gene_variant ; 844.0bp to feature; MODIFIER	silent_mutation	Average:36.206; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0212179937	C -> T	LOC_Os02g20670-LOC_Os02g20690	intergenic_region ; MODIFIER	silent_mutation	Average:36.206; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212179937	8.21E-07	NA	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	4.64E-07	1.55E-09	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	1.08E-06	NA	mr1093	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	8.88E-07	6.69E-10	mr1093	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	2.30E-11	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	1.56E-09	1.89E-18	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	1.06E-07	NA	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	1.25E-06	1.73E-14	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	1.98E-08	NA	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212179937	2.47E-08	6.35E-11	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 54 entries

Previous1 2 3 4 5 6Next

Search for Variation information by Variation ID:

Detailed information for vg0212179937:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact