Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0212173682:

Variant ID: vg0212173682 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12173682
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTTAACATCTTTGATCATCGACTTATACCCCGATGCCCCTTGGGCCAAATCATTAGCTTCAATATTTTGTTCTCAAGATACATGCTTCAATGTAACCA[G/T]
CCAAAATTCCTTCATCAGTTCTTGGCACTTCTCATTATAAACCATTAATGTATCATTTTTGCATTCATATTCTCCTGCCAATTGACTGATTACCAGCAAA

Reverse complement sequence

TTTGCTGGTAATCAGTCAATTGGCAGGAGAATATGAATGCAAAAATGATACATTAATGGTTTATAATGAGAAGTGCCAAGAACTGATGAAGGAATTTTGG[C/A]
TGGTTACATTGAAGCATGTATCTTGAGAACAAAATATTGAAGCTAATGATTTGGCCCAAGGGGCATCGGGGTATAAGTCGATGATCAAAGATGTTAAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.40%	3.90%	0.74%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.07%	0.00%	NA
All Japonica	1512	91.10%	7.10%	1.85%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	98.20%	0.80%	1.04%	0.00%	NA
Tropical Japonica	504	84.30%	13.90%	1.79%	0.00%	NA
Japonica Intermediate	241	82.60%	12.90%	4.56%	0.00%	NA
VI/Aromatic	96	31.20%	65.60%	3.12%	0.00%	NA
Intermediate	90	88.90%	8.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212173682	G -> T	LOC_Os02g20650.1	downstream_gene_variant ; 1852.0bp to feature; MODIFIER	silent_mutation	Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0212173682	G -> T	LOC_Os02g20670.1	downstream_gene_variant ; 4683.0bp to feature; MODIFIER	silent_mutation	Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0212173682	G -> T	LOC_Os02g20660.1	intron_variant ; MODIFIER	silent_mutation	Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212173682	NA	1.03E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682	NA	5.09E-08	mr1695	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682	NA	8.43E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682	NA	5.34E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682	NA	6.47E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682	NA	6.65E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682	NA	3.82E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251