| Variant ID: vg0212173682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12173682 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCTTAACATCTTTGATCATCGACTTATACCCCGATGCCCCTTGGGCCAAATCATTAGCTTCAATATTTTGTTCTCAAGATACATGCTTCAATGTAACCA[G/T]
CCAAAATTCCTTCATCAGTTCTTGGCACTTCTCATTATAAACCATTAATGTATCATTTTTGCATTCATATTCTCCTGCCAATTGACTGATTACCAGCAAA
TTTGCTGGTAATCAGTCAATTGGCAGGAGAATATGAATGCAAAAATGATACATTAATGGTTTATAATGAGAAGTGCCAAGAACTGATGAAGGAATTTTGG[C/A]
TGGTTACATTGAAGCATGTATCTTGAGAACAAAATATTGAAGCTAATGATTTGGCCCAAGGGGCATCGGGGTATAAGTCGATGATCAAAGATGTTAAGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 3.90% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 7.10% | 1.85% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 0.80% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 84.30% | 13.90% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 12.90% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 65.60% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212173682 | G -> T | LOC_Os02g20650.1 | downstream_gene_variant ; 1852.0bp to feature; MODIFIER | silent_mutation | Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0212173682 | G -> T | LOC_Os02g20670.1 | downstream_gene_variant ; 4683.0bp to feature; MODIFIER | silent_mutation | Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0212173682 | G -> T | LOC_Os02g20660.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212173682 | NA | 1.03E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212173682 | NA | 5.09E-08 | mr1695 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212173682 | NA | 8.43E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212173682 | NA | 5.34E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212173682 | NA | 6.47E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212173682 | NA | 6.65E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212173682 | NA | 3.82E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |