\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212173682:

Variant ID: vg0212173682 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12173682
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTTAACATCTTTGATCATCGACTTATACCCCGATGCCCCTTGGGCCAAATCATTAGCTTCAATATTTTGTTCTCAAGATACATGCTTCAATGTAACCA[G/T]
CCAAAATTCCTTCATCAGTTCTTGGCACTTCTCATTATAAACCATTAATGTATCATTTTTGCATTCATATTCTCCTGCCAATTGACTGATTACCAGCAAA

Reverse complement sequence

TTTGCTGGTAATCAGTCAATTGGCAGGAGAATATGAATGCAAAAATGATACATTAATGGTTTATAATGAGAAGTGCCAAGAACTGATGAAGGAATTTTGG[C/A]
TGGTTACATTGAAGCATGTATCTTGAGAACAAAATATTGAAGCTAATGATTTGGCCCAAGGGGCATCGGGGTATAAGTCGATGATCAAAGATGTTAAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 3.90% 0.74% 0.00% NA
All Indica  2759 99.70% 0.20% 0.07% 0.00% NA
All Japonica  1512 91.10% 7.10% 1.85% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 98.20% 0.80% 1.04% 0.00% NA
Tropical Japonica  504 84.30% 13.90% 1.79% 0.00% NA
Japonica Intermediate  241 82.60% 12.90% 4.56% 0.00% NA
VI/Aromatic  96 31.20% 65.60% 3.12% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212173682 G -> T LOC_Os02g20650.1 downstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0212173682 G -> T LOC_Os02g20670.1 downstream_gene_variant ; 4683.0bp to feature; MODIFIER silent_mutation Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0212173682 G -> T LOC_Os02g20660.1 intron_variant ; MODIFIER silent_mutation Average:34.998; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212173682 NA 1.03E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682 NA 5.09E-08 mr1695 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682 NA 8.43E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682 NA 5.34E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682 NA 6.47E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682 NA 6.65E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212173682 NA 3.82E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251