\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212084131:

Variant ID: vg0212084131 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12084131
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGTTTTTAAATTTGAGTTTAAAGTTTTCAAATATTGACTTGAAATTTTTCAAATAAAGATTTGAAAGTTTTAAAATAAGAGTTGAAAACTTTTAGA[T/C]
TTAAGTTGAAAGTATTAAAATCTTGGCTTGAAAATTTTGAAATCTAAGTTCAAATCTAGACTTGAAAGTTTTCAAATATTAGTTGAAAAGTTTCCAAATC

Reverse complement sequence

GATTTGGAAACTTTTCAACTAATATTTGAAAACTTTCAAGTCTAGATTTGAACTTAGATTTCAAAATTTTCAAGCCAAGATTTTAATACTTTCAACTTAA[A/G]
TCTAAAAGTTTTCAACTCTTATTTTAAAACTTTCAAATCTTTATTTGAAAAATTTCAAGTCAATATTTGAAAACTTTAAACTCAAATTTAAAAACTTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.20% 0.49% 0.00% NA
All Indica  2759 94.60% 4.50% 0.83% 0.00% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 64.30% 35.70% 0.00% 0.00% NA
Indica I  595 98.30% 0.30% 1.34% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 93.60% 6.20% 0.11% 0.00% NA
Indica Intermediate  786 92.00% 6.40% 1.65% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212084131 T -> C LOC_Os02g20480.1 upstream_gene_variant ; 4173.0bp to feature; MODIFIER silent_mutation Average:33.158; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0212084131 T -> C LOC_Os02g20490.1 upstream_gene_variant ; 1886.0bp to feature; MODIFIER silent_mutation Average:33.158; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0212084131 T -> C LOC_Os02g20480-LOC_Os02g20490 intergenic_region ; MODIFIER silent_mutation Average:33.158; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212084131 NA 1.45E-36 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 1.41E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 1.89E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 7.97E-40 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 1.56E-71 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 3.76E-72 mr1538 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 5.08E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 1.02E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 5.96E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 2.76E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 6.23E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 3.61E-57 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 7.90E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 1.85E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212084131 NA 9.18E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251