\
| Variant ID: vg0212053945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12053945 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCTTCCAAGCGCAGCCGCCGAATCCTCCATCTCCGGTCAGCATAGCTCCCGCTCGGCCGCGCCGCTCATCCCTCACCGGCACACCGCACCGTCCTCCAC[C/T]
GCTCGCCGTCGCCGCCGAGAAGAGGGACACAGCTGCCGTGCGCGTCCGAGTGGATGTGGTGTGAGGCGGCCGGGTTTGAACTAGCCAACGTCATATATAC
GTATATATGACGTTGGCTAGTTCAAACCCGGCCGCCTCACACCACATCCACTCGGACGCGCACGGCAGCTGTGTCCCTCTTCTCGGCGGCGACGGCGAGC[G/A]
GTGGAGGACGGTGCGGTGTGCCGGTGAGGGATGAGCGGCGCGGCCGAGCGGGAGCTATGCTGACCGGAGATGGAGGATTCGGCGGCTGCGCTTGGAAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 5.90% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.80% | 17.40% | 1.85% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.00% | 3.40% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 57.50% | 38.90% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 17.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212053945 | C -> T | LOC_Os02g20420.1 | upstream_gene_variant ; 1852.0bp to feature; MODIFIER | silent_mutation | Average:75.27; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0212053945 | C -> T | LOC_Os02g20430.1 | upstream_gene_variant ; 888.0bp to feature; MODIFIER | silent_mutation | Average:75.27; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0212053945 | C -> T | LOC_Os02g20420-LOC_Os02g20430 | intergenic_region ; MODIFIER | silent_mutation | Average:75.27; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212053945 | NA | 3.21E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212053945 | NA | 6.56E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212053945 | 1.75E-06 | 1.42E-08 | mr1042_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212053945 | NA | 1.46E-07 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212053945 | 9.78E-06 | 1.18E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212053945 | 4.55E-07 | 6.64E-11 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212053945 | 1.15E-07 | 8.21E-10 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |