Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212043326:

Variant ID: vg0212043326 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12043326
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGTGACACGATCAACAACTTCTAACTTAGATTCTTGGAAACACACAACCAACGCATTGGAGGAAACAACAGACTCCTTCACCAGGGAGCACTTCACAG[C/T]
GTTGTTTAGCCCTCTTACATTCCATACTAGAAGATTGAAACTCACTCCTGACATTACAACAACCAGACACCCCCAGCCCCCGGCTAACACAGCATACAAA

Reverse complement sequence

TTTGTATGCTGTGTTAGCCGGGGGCTGGGGGTGTCTGGTTGTTGTAATGTCAGGAGTGAGTTTCAATCTTCTAGTATGGAATGTAAGAGGGCTAAACAAC[G/A]
CTGTGAAGTGCTCCCTGGTGAAGGAGTCTGTTGTTTCCTCCAATGCGTTGGTTGTGTGTTTCCAAGAATCTAAGTTAGAAGTTGTTGATCGTGTCACTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.60%	5.80%	2.64%	0.00%	NA
All Indica	2759	86.10%	9.70%	4.24%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.00%	NA
Aus	269	98.50%	0.00%	1.49%	0.00%	NA
Indica I	595	92.80%	0.00%	7.23%	0.00%	NA
Indica II	465	66.50%	25.60%	7.96%	0.00%	NA
Indica III	913	88.80%	10.50%	0.66%	0.00%	NA
Indica Intermediate	786	89.40%	6.60%	3.94%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	5.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212043326	C -> T	LOC_Os02g20420.1	intron_variant ; MODIFIER	silent_mutation	Average:67.083; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212043326	NA	1.22E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	3.86E-07	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	4.69E-06	mr1607	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	8.88E-07	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	4.69E-11	2.72E-18	mr1855	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	1.64E-10	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	2.52E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	2.66E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	3.76E-07	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	5.60E-12	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	1.35E-07	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	2.11E-09	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212043326	NA	3.19E-07	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251