\
| Variant ID: vg0211892318 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11892318 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACACTTAAATCACCATATGTCACATTTTAAAATTATAAATATTTCAATTAAATCAATGTCCTGAAAATCAGAAATAATCTTAGAAATTTTGAGAAAAAAA[T/A]
TAAACCTATCATCATTGGTTTTAATGGTTTTAAGTTACATTATTTGGAGAAATTAGAAAAATAAATCGCATCTACCTCCTTGTCCCCCTCACATGCGCGC
GCGCGCATGTGAGGGGGACAAGGAGGTAGATGCGATTTATTTTTCTAATTTCTCCAAATAATGTAACTTAAAACCATTAAAACCAATGATGATAGGTTTA[A/T]
TTTTTTTCTCAAAATTTCTAAGATTATTTCTGATTTTCAGGACATTGATTTAATTGAAATATTTATAATTTTAAAATGTGACATATGGTGATTTAAGTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 0.90% | 1.02% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 1.60% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 88.90% | 7.20% | 3.87% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.00% | 1.51% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 0.00% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211892318 | T -> A | LOC_Os02g20180.1 | upstream_gene_variant ; 3183.0bp to feature; MODIFIER | silent_mutation | Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0211892318 | T -> A | LOC_Os02g20190.1 | downstream_gene_variant ; 3307.0bp to feature; MODIFIER | silent_mutation | Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0211892318 | T -> A | LOC_Os02g20200.1 | downstream_gene_variant ; 4783.0bp to feature; MODIFIER | silent_mutation | Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0211892318 | T -> A | LOC_Os02g20180-LOC_Os02g20190 | intergenic_region ; MODIFIER | silent_mutation | Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211892318 | NA | 6.56E-06 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | NA | 3.50E-09 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | NA | 3.09E-10 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | NA | 9.25E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | 4.31E-06 | 6.22E-09 | mr1610_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | NA | 4.50E-09 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | 3.14E-06 | 1.86E-14 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | NA | 4.70E-09 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | NA | 7.81E-11 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211892318 | NA | 1.22E-09 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |