\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211892318:

Variant ID: vg0211892318 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11892318
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACTTAAATCACCATATGTCACATTTTAAAATTATAAATATTTCAATTAAATCAATGTCCTGAAAATCAGAAATAATCTTAGAAATTTTGAGAAAAAAA[T/A]
TAAACCTATCATCATTGGTTTTAATGGTTTTAAGTTACATTATTTGGAGAAATTAGAAAAATAAATCGCATCTACCTCCTTGTCCCCCTCACATGCGCGC

Reverse complement sequence

GCGCGCATGTGAGGGGGACAAGGAGGTAGATGCGATTTATTTTTCTAATTTCTCCAAATAATGTAACTTAAAACCATTAAAACCAATGATGATAGGTTTA[A/T]
TTTTTTTCTCAAAATTTCTAAGATTATTTCTGATTTTCAGGACATTGATTTAATTGAAATATTTATAATTTTAAAATGTGACATATGGTGATTTAAGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 0.90% 1.02% 0.00% NA
All Indica  2759 96.80% 1.60% 1.63% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 88.90% 7.20% 3.87% 0.00% NA
Indica II  465 98.50% 0.00% 1.51% 0.00% NA
Indica III  913 99.70% 0.00% 0.33% 0.00% NA
Indica Intermediate  786 98.50% 0.00% 1.53% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211892318 T -> A LOC_Os02g20180.1 upstream_gene_variant ; 3183.0bp to feature; MODIFIER silent_mutation Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0211892318 T -> A LOC_Os02g20190.1 downstream_gene_variant ; 3307.0bp to feature; MODIFIER silent_mutation Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0211892318 T -> A LOC_Os02g20200.1 downstream_gene_variant ; 4783.0bp to feature; MODIFIER silent_mutation Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0211892318 T -> A LOC_Os02g20180-LOC_Os02g20190 intergenic_region ; MODIFIER silent_mutation Average:28.652; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211892318 NA 6.56E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 NA 3.50E-09 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 NA 3.09E-10 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 NA 9.25E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 4.31E-06 6.22E-09 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 NA 4.50E-09 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 3.14E-06 1.86E-14 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 NA 4.70E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 NA 7.81E-11 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211892318 NA 1.22E-09 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251