\
| Variant ID: vg0211870399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11870399 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGAATCGGATGGAGTAGAATATAGGACTCCATAACATAGTTCTACTTGAAAAATATGTACAGTAGGTTATATACATAACCCCTAATTGCGCATGTAATC[C/T]
GCAACATAGTTCTACGAGAAAAATATGTACAGTAGGTTATATATGCACAACCACTAATTGCGCATGTAAAAAGTTCTACGAAAGGGTCTGCACGAAACTT
AAGTTTCGTGCAGACCCTTTCGTAGAACTTTTTACATGCGCAATTAGTGGTTGTGCATATATAACCTACTGTACATATTTTTCTCGTAGAACTATGTTGC[G/A]
GATTACATGCGCAATTAGGGGTTATGTATATAACCTACTGTACATATTTTTCAAGTAGAACTATGTTATGGAGTCCTATATTCTACTCCATCCGATTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 1.20% | 1.42% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 2.10% | 2.36% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 83.20% | 8.40% | 8.40% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 0.80% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211870399 | C -> T | LOC_Os02g20140.1 | upstream_gene_variant ; 759.0bp to feature; MODIFIER | silent_mutation | Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0211870399 | C -> T | LOC_Os02g20150.1 | downstream_gene_variant ; 4877.0bp to feature; MODIFIER | silent_mutation | Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0211870399 | C -> T | LOC_Os02g20140-LOC_Os02g20150 | intergenic_region ; MODIFIER | silent_mutation | Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211870399 | NA | 1.46E-06 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | NA | 5.42E-09 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | NA | 3.31E-11 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | NA | 7.90E-07 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | NA | 1.20E-06 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | 4.53E-06 | 8.64E-12 | mr1317_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | NA | 2.73E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | 5.24E-06 | 2.57E-09 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | 4.15E-07 | 5.25E-11 | mr1818_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | 3.85E-09 | 1.17E-20 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | 3.04E-07 | 1.46E-11 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | 8.46E-08 | 1.19E-15 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211870399 | NA | 7.45E-12 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |