\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211870399:

Variant ID: vg0211870399 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11870399
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAATCGGATGGAGTAGAATATAGGACTCCATAACATAGTTCTACTTGAAAAATATGTACAGTAGGTTATATACATAACCCCTAATTGCGCATGTAATC[C/T]
GCAACATAGTTCTACGAGAAAAATATGTACAGTAGGTTATATATGCACAACCACTAATTGCGCATGTAAAAAGTTCTACGAAAGGGTCTGCACGAAACTT

Reverse complement sequence

AAGTTTCGTGCAGACCCTTTCGTAGAACTTTTTACATGCGCAATTAGTGGTTGTGCATATATAACCTACTGTACATATTTTTCTCGTAGAACTATGTTGC[G/A]
GATTACATGCGCAATTAGGGGTTATGTATATAACCTACTGTACATATTTTTCAAGTAGAACTATGTTATGGAGTCCTATATTCTACTCCATCCGATTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.20% 1.42% 0.00% NA
All Indica  2759 95.60% 2.10% 2.36% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 83.20% 8.40% 8.40% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.60% 0.10% 0.33% 0.00% NA
Indica Intermediate  786 98.00% 0.80% 1.27% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211870399 C -> T LOC_Os02g20140.1 upstream_gene_variant ; 759.0bp to feature; MODIFIER silent_mutation Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0211870399 C -> T LOC_Os02g20150.1 downstream_gene_variant ; 4877.0bp to feature; MODIFIER silent_mutation Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0211870399 C -> T LOC_Os02g20140-LOC_Os02g20150 intergenic_region ; MODIFIER silent_mutation Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211870399 NA 1.46E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 NA 5.42E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 NA 3.31E-11 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 NA 7.90E-07 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 NA 1.20E-06 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 4.53E-06 8.64E-12 mr1317_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 NA 2.73E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 5.24E-06 2.57E-09 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 4.15E-07 5.25E-11 mr1818_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 3.85E-09 1.17E-20 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 3.04E-07 1.46E-11 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 8.46E-08 1.19E-15 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399 NA 7.45E-12 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251