RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0211870399:

Variant ID: vg0211870399 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11870399
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAATCGGATGGAGTAGAATATAGGACTCCATAACATAGTTCTACTTGAAAAATATGTACAGTAGGTTATATACATAACCCCTAATTGCGCATGTAATC[C/T]
GCAACATAGTTCTACGAGAAAAATATGTACAGTAGGTTATATATGCACAACCACTAATTGCGCATGTAAAAAGTTCTACGAAAGGGTCTGCACGAAACTT

Reverse complement sequence

AAGTTTCGTGCAGACCCTTTCGTAGAACTTTTTACATGCGCAATTAGTGGTTGTGCATATATAACCTACTGTACATATTTTTCTCGTAGAACTATGTTGC[G/A]
GATTACATGCGCAATTAGGGGTTATGTATATAACCTACTGTACATATTTTTCAAGTAGAACTATGTTATGGAGTCCTATATTCTACTCCATCCGATTCAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	1.20%	1.42%	0.00%	NA
All Indica	2759	95.60%	2.10%	2.36%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	83.20%	8.40%	8.40%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	99.60%	0.10%	0.33%	0.00%	NA
Indica Intermediate	786	98.00%	0.80%	1.27%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211870399	C -> T	LOC_Os02g20140.1	upstream_gene_variant ; 759.0bp to feature; MODIFIER	silent_mutation	Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0211870399	C -> T	LOC_Os02g20150.1	downstream_gene_variant ; 4877.0bp to feature; MODIFIER	silent_mutation	Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0211870399	C -> T	LOC_Os02g20140-LOC_Os02g20150	intergenic_region ; MODIFIER	silent_mutation	Average:37.146; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211870399	NA	1.46E-06	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	NA	5.42E-09	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	NA	3.31E-11	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	NA	7.90E-07	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	NA	1.20E-06	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	4.53E-06	8.64E-12	mr1317_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	NA	2.73E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	5.24E-06	2.57E-09	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	4.15E-07	5.25E-11	mr1818_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211870399	3.85E-09	1.17E-20	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0211870399:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact