\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211842905:

Variant ID: vg0211842905 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11842905
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAGCAATGATGCAGCAAGCACGGGACCAGTTCCTGAATTCATTCATGCAGACTCGCAAGCGAACGTTTGTTCAGAAGTATAAGATAAAAGTGGTTGCT[A/G]
ATAGTCCTGAAACCGGTTCTTCTAAAGATGGAGAGGTAAAACAAGCTCCTGAAGGCTCGGCTCACCTGAGCAATAAAGGTGCTACTGACGGTTCTCTAGG

Reverse complement sequence

CCTAGAGAACCGTCAGTAGCACCTTTATTGCTCAGGTGAGCCGAGCCTTCAGGAGCTTGTTTTACCTCTCCATCTTTAGAAGAACCGGTTTCAGGACTAT[T/C]
AGCAACCACTTTTATCTTATACTTCTGAACAAACGTTCGCTTGCGAGTCTGCATGAATGAATTCAGGAACTGGTCCCGTGCTTGCTGCATCATTGCTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 8.80% 21.20% 38.74% NA
All Indica  2759 8.00% 0.50% 30.45% 61.11% NA
All Japonica  1512 66.90% 26.10% 6.22% 0.73% NA
Aus  269 39.80% 0.00% 18.96% 41.26% NA
Indica I  595 7.10% 0.30% 38.66% 53.95% NA
Indica II  465 7.10% 0.60% 30.11% 62.15% NA
Indica III  913 6.20% 0.10% 23.88% 69.77% NA
Indica Intermediate  786 11.20% 0.90% 32.06% 55.85% NA
Temperate Japonica  767 45.10% 46.80% 7.04% 1.04% NA
Tropical Japonica  504 91.50% 3.20% 4.96% 0.40% NA
Japonica Intermediate  241 85.10% 8.30% 6.22% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 48.90% 7.80% 17.78% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211842905 A -> G LOC_Os02g20110.1 missense_variant ; p.Asn82Asp; MODERATE nonsynonymous_codon Average:11.467; most accessible tissue: Callus, score: 18.904 benign -0.407 TOLERATED 1.00
vg0211842905 A -> DEL LOC_Os02g20110.1 N frameshift_variant Average:11.467; most accessible tissue: Callus, score: 18.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211842905 NA 7.12E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 1.87E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 1.37E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 5.72E-07 NA mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 7.61E-06 3.58E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 8.61E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 7.61E-06 NA mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 6.35E-06 6.35E-06 mr1320 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 1.56E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 8.73E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 9.79E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 8.57E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 9.55E-08 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 3.33E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 5.91E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 1.34E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 5.21E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 5.78E-06 mr1685 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 1.70E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 1.60E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 5.36E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 8.37E-06 1.58E-09 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 9.02E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 1.82E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 3.21E-08 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905 NA 2.45E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251