Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211842905:

Variant ID: vg0211842905 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11842905
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAGCAATGATGCAGCAAGCACGGGACCAGTTCCTGAATTCATTCATGCAGACTCGCAAGCGAACGTTTGTTCAGAAGTATAAGATAAAAGTGGTTGCT[A/G]
ATAGTCCTGAAACCGGTTCTTCTAAAGATGGAGAGGTAAAACAAGCTCCTGAAGGCTCGGCTCACCTGAGCAATAAAGGTGCTACTGACGGTTCTCTAGG

Reverse complement sequence

CCTAGAGAACCGTCAGTAGCACCTTTATTGCTCAGGTGAGCCGAGCCTTCAGGAGCTTGTTTTACCTCTCCATCTTTAGAAGAACCGGTTTCAGGACTAT[T/C]
AGCAACCACTTTTATCTTATACTTCTGAACAAACGTTCGCTTGCGAGTCTGCATGAATGAATTCAGGAACTGGTCCCGTGCTTGCTGCATCATTGCTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.30%	8.80%	21.20%	38.74%	NA
All Indica	2759	8.00%	0.50%	30.45%	61.11%	NA
All Japonica	1512	66.90%	26.10%	6.22%	0.73%	NA
Aus	269	39.80%	0.00%	18.96%	41.26%	NA
Indica I	595	7.10%	0.30%	38.66%	53.95%	NA
Indica II	465	7.10%	0.60%	30.11%	62.15%	NA
Indica III	913	6.20%	0.10%	23.88%	69.77%	NA
Indica Intermediate	786	11.20%	0.90%	32.06%	55.85%	NA
Temperate Japonica	767	45.10%	46.80%	7.04%	1.04%	NA
Tropical Japonica	504	91.50%	3.20%	4.96%	0.40%	NA
Japonica Intermediate	241	85.10%	8.30%	6.22%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	48.90%	7.80%	17.78%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211842905	A -> G	LOC_Os02g20110.1	missense_variant ; p.Asn82Asp; MODERATE	nonsynonymous_codon	Average:11.467; most accessible tissue: Callus, score: 18.904	benign	-0.407	TOLERATED	1.00
vg0211842905	A -> DEL	LOC_Os02g20110.1	N	frameshift_variant	Average:11.467; most accessible tissue: Callus, score: 18.904	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211842905	NA	7.12E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	1.87E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	1.37E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	5.72E-07	NA	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	7.61E-06	3.58E-09	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	8.61E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	7.61E-06	NA	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	6.35E-06	6.35E-06	mr1320	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	1.56E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	8.73E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	9.79E-06	mr1397	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	8.57E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	9.55E-08	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	3.33E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	5.91E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	1.34E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	5.21E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	5.78E-06	mr1685	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	1.70E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	1.60E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	5.36E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	8.37E-06	1.58E-09	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	9.02E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	1.82E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	3.21E-08	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842905	NA	2.45E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251