Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0211842214:

Variant ID: vg0211842214 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11842214
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGTTTAGTATATTCTACTTGCTTTAACATCTTAACATAGAGTGGTATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATGAA[C/T]
GCATATAGTCTAATTATTAATATATATTTCGATCTAAGTGATTTATACTGTCTCGGCATGGCGACCGATCTATCCCAATCACTTGATTTAAGTATATATC

Reverse complement sequence

GATATATACTTAAATCAAGTGATTGGGATAGATCGGTCGCCATGCCGAGACAGTATAAATCACTTAGATCGAAATATATATTAATAATTAGACTATATGC[G/A]
TTCATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATACCACTCTATGTTAAGATGTTAAAGCAAGTAGAATATACTAAACAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	1.40%	11.85%	0.02%	NA
All Indica	2759	80.10%	2.20%	17.72%	0.04%	NA
All Japonica	1512	99.10%	0.00%	0.93%	0.00%	NA
Aus	269	79.60%	1.50%	18.96%	0.00%	NA
Indica I	595	80.00%	1.50%	18.49%	0.00%	NA
Indica II	465	80.40%	2.40%	17.20%	0.00%	NA
Indica III	913	81.30%	2.20%	16.54%	0.00%	NA
Indica Intermediate	786	78.50%	2.50%	18.83%	0.13%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	97.80%	0.00%	2.18%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	0.00%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211842214	C -> T	LOC_Os02g20100.1	upstream_gene_variant ; 1372.0bp to feature; MODIFIER	silent_mutation	Average:15.5; most accessible tissue: Callus, score: 26.725	N	N	N	N
vg0211842214	C -> T	LOC_Os02g20110.1	upstream_gene_variant ; 448.0bp to feature; MODIFIER	silent_mutation	Average:15.5; most accessible tissue: Callus, score: 26.725	N	N	N	N
vg0211842214	C -> T	LOC_Os02g20100-LOC_Os02g20110	intergenic_region ; MODIFIER	silent_mutation	Average:15.5; most accessible tissue: Callus, score: 26.725	N	N	N	N
vg0211842214	C -> DEL	N	N	silent_mutation	Average:15.5; most accessible tissue: Callus, score: 26.725	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211842214	3.87E-06	NA	mr1010_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842214	2.00E-06	2.00E-06	mr1367_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842214	1.10E-06	6.99E-07	mr1469_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842214	6.51E-07	1.73E-06	mr1469_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842214	1.71E-06	NA	mr1637_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211842214	4.51E-07	1.38E-06	mr1637_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251