\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211790176:

Variant ID: vg0211790176 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11790176
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTCGTTTAATTTGGATTCGAGCATGAATTGGTTCTTATCCCTTGTCCATCTTTAGATGTCAGTCCTATCCCTCGATTGCAAGCGCCGCTCCGAGCT[T/C,G]
CAGAGTCGCCGCCCTTAGCTTTATTGTCTTCCTAGTTTTGTTTGCCTGCTAGTTTCCGTGCATAGGTTTGTTGCTGGTGGATTAGTCGGCGGTCGATATC

Reverse complement sequence

GATATCGACCGCCGACTAATCCACCAGCAACAAACCTATGCACGGAAACTAGCAGGCAAACAAAACTAGGAAGACAATAAAGCTAAGGGCGGCGACTCTG[A/G,C]
AGCTCGGAGCGGCGCTTGCAATCGAGGGATAGGACTGACATCTAAAGATGGACAAGGGATAAGAACCAATTCATGCTCGAATCCAAATTAAACGAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 0.40% 1.57% 3.83% C: 0.13%
All Indica  2759 90.40% 0.50% 2.43% 6.42% C: 0.22%
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 98.10% 0.70% 1.12% 0.00% NA
Indica I  595 91.90% 0.00% 2.35% 5.21% C: 0.50%
Indica II  465 84.50% 0.20% 3.66% 11.61% NA
Indica III  913 91.80% 1.30% 1.42% 5.26% C: 0.22%
Indica Intermediate  786 91.10% 0.30% 2.93% 5.60% C: 0.13%
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 0.00% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211790176 T -> G LOC_Os02g20020.1 upstream_gene_variant ; 260.0bp to feature; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 38.435 N N N N
vg0211790176 T -> G LOC_Os02g20010.1 downstream_gene_variant ; 4945.0bp to feature; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 38.435 N N N N
vg0211790176 T -> G LOC_Os02g20010-LOC_Os02g20020 intergenic_region ; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 38.435 N N N N
vg0211790176 T -> DEL N N silent_mutation Average:16.742; most accessible tissue: Callus, score: 38.435 N N N N
vg0211790176 T -> C LOC_Os02g20020.1 upstream_gene_variant ; 260.0bp to feature; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 38.435 N N N N
vg0211790176 T -> C LOC_Os02g20010.1 downstream_gene_variant ; 4945.0bp to feature; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 38.435 N N N N
vg0211790176 T -> C LOC_Os02g20010-LOC_Os02g20020 intergenic_region ; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 38.435 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211790176 2.44E-07 1.91E-07 mr1193 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211790176 6.50E-06 6.59E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211790176 1.44E-07 2.12E-08 mr1716 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211790176 4.80E-06 4.80E-06 mr1823 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251