\
| Variant ID: vg0211790176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11790176 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 101. )
TTGCTTCGTTTAATTTGGATTCGAGCATGAATTGGTTCTTATCCCTTGTCCATCTTTAGATGTCAGTCCTATCCCTCGATTGCAAGCGCCGCTCCGAGCT[T/C,G]
CAGAGTCGCCGCCCTTAGCTTTATTGTCTTCCTAGTTTTGTTTGCCTGCTAGTTTCCGTGCATAGGTTTGTTGCTGGTGGATTAGTCGGCGGTCGATATC
GATATCGACCGCCGACTAATCCACCAGCAACAAACCTATGCACGGAAACTAGCAGGCAAACAAAACTAGGAAGACAATAAAGCTAAGGGCGGCGACTCTG[A/G,C]
AGCTCGGAGCGGCGCTTGCAATCGAGGGATAGGACTGACATCTAAAGATGGACAAGGGATAAGAACCAATTCATGCTCGAATCCAAATTAAACGAAGCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 0.40% | 1.57% | 3.83% | C: 0.13% |
| All Indica | 2759 | 90.40% | 0.50% | 2.43% | 6.42% | C: 0.22% |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 91.90% | 0.00% | 2.35% | 5.21% | C: 0.50% |
| Indica II | 465 | 84.50% | 0.20% | 3.66% | 11.61% | NA |
| Indica III | 913 | 91.80% | 1.30% | 1.42% | 5.26% | C: 0.22% |
| Indica Intermediate | 786 | 91.10% | 0.30% | 2.93% | 5.60% | C: 0.13% |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211790176 | T -> G | LOC_Os02g20020.1 | upstream_gene_variant ; 260.0bp to feature; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 38.435 | N | N | N | N |
| vg0211790176 | T -> G | LOC_Os02g20010.1 | downstream_gene_variant ; 4945.0bp to feature; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 38.435 | N | N | N | N |
| vg0211790176 | T -> G | LOC_Os02g20010-LOC_Os02g20020 | intergenic_region ; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 38.435 | N | N | N | N |
| vg0211790176 | T -> DEL | N | N | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 38.435 | N | N | N | N |
| vg0211790176 | T -> C | LOC_Os02g20020.1 | upstream_gene_variant ; 260.0bp to feature; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 38.435 | N | N | N | N |
| vg0211790176 | T -> C | LOC_Os02g20010.1 | downstream_gene_variant ; 4945.0bp to feature; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 38.435 | N | N | N | N |
| vg0211790176 | T -> C | LOC_Os02g20010-LOC_Os02g20020 | intergenic_region ; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 38.435 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211790176 | 2.44E-07 | 1.91E-07 | mr1193 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211790176 | 6.50E-06 | 6.59E-06 | mr1550 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211790176 | 1.44E-07 | 2.12E-08 | mr1716 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211790176 | 4.80E-06 | 4.80E-06 | mr1823 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |