RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0211784990:

Variant ID: vg0211784990 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11784990
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CCACTTCTTTTTGTTCTAGGGGCTGAACTCTTGCAAAGAACAGTAAATAGGGCTTTCAATCTTGGATTAATTTCAAAGCCAATCAATGAAAATGATGGCA[G/C]
TGGGTTCCCCATCATCCAATATGCTGATGACACTTTGATCCTGCTAAAAGCTTCACAAAAGGAAATCTTTTGCTTCAAGGCACTACTAAATATGTTTGCT

Reverse complement sequence

AGCAAACATATTTAGTAGTGCCTTGAAGCAAAAGATTTCCTTTTGTGAAGCTTTTAGCAGGATCAAAGTGTCATCAGCATATTGGATGATGGGGAACCCA[C/G]
TGCCATCATTTTCATTGATTGGCTTTGAAATTAATCCAAGATTGAAAGCCCTATTTACTGTTCTTTGCAAGAGTTCAGCCCCTAGAACAAAAAGAAGTGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.50%	16.80%	3.36%	30.39%	NA
All Indica	2759	27.20%	23.00%	4.82%	44.98%	NA
All Japonica	1512	91.70%	0.20%	0.00%	8.13%	NA
Aus	269	28.60%	55.00%	9.29%	7.06%	NA
Indica I	595	12.30%	19.70%	5.04%	63.03%	NA
Indica II	465	18.10%	34.40%	4.52%	43.01%	NA
Indica III	913	41.20%	20.20%	4.16%	34.50%	NA
Indica Intermediate	786	27.70%	22.00%	5.60%	44.66%	NA
Temperate Japonica	767	91.30%	0.10%	0.00%	8.60%	NA
Tropical Japonica	504	93.70%	0.20%	0.00%	6.15%	NA
Japonica Intermediate	241	88.80%	0.40%	0.00%	10.79%	NA
VI/Aromatic	96	79.20%	0.00%	0.00%	20.83%	NA
Intermediate	90	53.30%	8.90%	1.11%	36.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211784990	G -> DEL	LOC_Os02g20010.1	N	frameshift_variant	Average:16.256; most accessible tissue: Callus, score: 52.259	N	N	N	N
vg0211784990	G -> C	LOC_Os02g20010.1	missense_variant ; p.Ser947Thr; MODERATE	nonsynonymous_codon ; S947T	Average:16.256; most accessible tissue: Callus, score: 52.259	benign	1.046	TOLERATED	0.65

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211784990	NA	4.05E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	4.17E-06	8.06E-07	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	3.30E-06	1.51E-08	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	6.86E-08	3.75E-13	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	2.01E-07	3.99E-12	mr1709	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	NA	2.86E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	NA	2.55E-06	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	6.90E-06	2.27E-14	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784990	NA	2.38E-12	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0211784990:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact