RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0211784502:

Variant ID: vg0211784502 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11784502
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTGAATCTACAGATTTACAGATTCTGAATAATTCTTACATCACCATTGTGCCAAAAAAAAACTTCTCCAGAAACAGTTAATGATTTCAGGCCAATTTC[T/C]
CTAATGGGTTTGAGCCTTAAGTTCCTTACCAAATTGATGGCTGATAGATTGCAAGGTGTGATTCTCAAAGTGGTTAGTGAAAACCAATATGGATTCATCA

Reverse complement sequence

TGATGAATCCATATTGGTTTTCACTAACCACTTTGAGAATCACACCTTGCAATCTATCAGCCATCAATTTGGTAAGGAACTTAAGGCTCAAACCCATTAG[A/G]
GAAATTGGCCTGAAATCATTAACTGTTTCTGGAGAAGTTTTTTTTTGGCACAATGGTGATGTAAGAATTATTCAGAATCTGTAAATCTGTAGATTCAACA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.00%	16.60%	5.99%	34.41%	NA
All Indica	2759	10.60%	22.80%	9.64%	56.94%	NA
All Japonica	1512	98.30%	0.10%	0.13%	1.46%	NA
Aus	269	39.40%	53.50%	3.72%	3.35%	NA
Indica I	595	6.10%	19.30%	5.55%	69.08%	NA
Indica II	465	8.40%	34.20%	6.88%	50.54%	NA
Indica III	913	13.80%	20.30%	14.35%	51.59%	NA
Indica Intermediate	786	11.70%	21.60%	8.91%	57.76%	NA
Temperate Japonica	767	99.00%	0.10%	0.00%	0.91%	NA
Tropical Japonica	504	97.40%	0.20%	0.20%	2.18%	NA
Japonica Intermediate	241	97.90%	0.00%	0.41%	1.66%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	8.90%	5.56%	26.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211784502	T -> DEL	LOC_Os02g20010.1	N	frameshift_variant	Average:14.621; most accessible tissue: Callus, score: 35.53	N	N	N	N
vg0211784502	T -> C	LOC_Os02g20010.1	synonymous_variant ; p.Ser784Ser; LOW	synonymous_codon	Average:14.621; most accessible tissue: Callus, score: 35.53	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211784502	NA	3.13E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784502	5.24E-06	6.18E-07	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784502	1.61E-06	6.46E-09	mr1547	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784502	3.29E-08	3.69E-14	mr1709	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784502	3.46E-07	5.31E-12	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784502	NA	9.30E-07	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784502	8.08E-07	2.31E-15	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211784502	NA	8.68E-13	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0211784502:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact