Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0211778650:

Variant ID: vg0211778650 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11778650
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGTCATGAACCAACACGTCTCCCTTGTAGGAAATAAGTAAGCATCCTAATAAAAATTGGGCGAATAGCTAATTTAGTCTCTCAAATTTCACGAAGGCT[T/C]
AATTTGGTCCTCCAGGTTTCATTTTGTCCACATAAGTCCTCTAAGTATTTGTTTTGGCTTAAAATCGTCCTTGGATCCACTTAATATGCCATATGGCTAT

Reverse complement sequence

ATAGCCATATGGCATATTAAGTGGATCCAAGGACGATTTTAAGCCAAAACAAATACTTAGAGGACTTATGTGGACAAAATGAAACCTGGAGGACCAAATT[A/G]
AGCCTTCGTGAAATTTGAGAGACTAAATTAGCTATTCGCCCAATTTTTATTAGGATGCTTACTTATTTCCTACAAGGGAGACGTGTTGGTTCATGACTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.90%	4.00%	0.30%	58.87%	NA
All Indica	2759	3.70%	3.00%	0.43%	92.82%	NA
All Japonica	1512	98.20%	0.00%	0.07%	1.72%	NA
Aus	269	2.60%	37.90%	0.00%	59.48%	NA
Indica I	595	5.40%	0.00%	0.34%	94.29%	NA
Indica II	465	4.30%	1.10%	0.43%	94.19%	NA
Indica III	913	1.90%	4.50%	0.22%	93.43%	NA
Indica Intermediate	786	4.20%	4.80%	0.76%	90.20%	NA
Temperate Japonica	767	99.00%	0.00%	0.13%	0.91%	NA
Tropical Japonica	504	97.20%	0.00%	0.00%	2.78%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	1.10%	1.11%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211778650	T -> DEL	N	N	silent_mutation	Average:18.643; most accessible tissue: Callus, score: 39.315	N	N	N	N
vg0211778650	T -> C	LOC_Os02g20010.1	upstream_gene_variant ; 576.0bp to feature; MODIFIER	silent_mutation	Average:18.643; most accessible tissue: Callus, score: 39.315	N	N	N	N
vg0211778650	T -> C	LOC_Os02g20000.1	downstream_gene_variant ; 708.0bp to feature; MODIFIER	silent_mutation	Average:18.643; most accessible tissue: Callus, score: 39.315	N	N	N	N
vg0211778650	T -> C	LOC_Os02g20000-LOC_Os02g20010	intergenic_region ; MODIFIER	silent_mutation	Average:18.643; most accessible tissue: Callus, score: 39.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211778650	2.21E-06	NA	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778650	NA	1.58E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778650	6.46E-06	NA	mr1619	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251