\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211778650:

Variant ID: vg0211778650 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11778650
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCATGAACCAACACGTCTCCCTTGTAGGAAATAAGTAAGCATCCTAATAAAAATTGGGCGAATAGCTAATTTAGTCTCTCAAATTTCACGAAGGCT[T/C]
AATTTGGTCCTCCAGGTTTCATTTTGTCCACATAAGTCCTCTAAGTATTTGTTTTGGCTTAAAATCGTCCTTGGATCCACTTAATATGCCATATGGCTAT

Reverse complement sequence

ATAGCCATATGGCATATTAAGTGGATCCAAGGACGATTTTAAGCCAAAACAAATACTTAGAGGACTTATGTGGACAAAATGAAACCTGGAGGACCAAATT[A/G]
AGCCTTCGTGAAATTTGAGAGACTAAATTAGCTATTCGCCCAATTTTTATTAGGATGCTTACTTATTTCCTACAAGGGAGACGTGTTGGTTCATGACTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 4.00% 0.30% 58.87% NA
All Indica  2759 3.70% 3.00% 0.43% 92.82% NA
All Japonica  1512 98.20% 0.00% 0.07% 1.72% NA
Aus  269 2.60% 37.90% 0.00% 59.48% NA
Indica I  595 5.40% 0.00% 0.34% 94.29% NA
Indica II  465 4.30% 1.10% 0.43% 94.19% NA
Indica III  913 1.90% 4.50% 0.22% 93.43% NA
Indica Intermediate  786 4.20% 4.80% 0.76% 90.20% NA
Temperate Japonica  767 99.00% 0.00% 0.13% 0.91% NA
Tropical Japonica  504 97.20% 0.00% 0.00% 2.78% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 58.90% 1.10% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211778650 T -> DEL N N silent_mutation Average:18.643; most accessible tissue: Callus, score: 39.315 N N N N
vg0211778650 T -> C LOC_Os02g20010.1 upstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:18.643; most accessible tissue: Callus, score: 39.315 N N N N
vg0211778650 T -> C LOC_Os02g20000.1 downstream_gene_variant ; 708.0bp to feature; MODIFIER silent_mutation Average:18.643; most accessible tissue: Callus, score: 39.315 N N N N
vg0211778650 T -> C LOC_Os02g20000-LOC_Os02g20010 intergenic_region ; MODIFIER silent_mutation Average:18.643; most accessible tissue: Callus, score: 39.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211778650 2.21E-06 NA mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778650 NA 1.58E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778650 6.46E-06 NA mr1619 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251