\
| Variant ID: vg0211778484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11778484 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCACATGTAGCAGTACTTCTTCTCACAATTCGTTCGTCGCTGGTTAACACTAAACCGAGAAGCCTCTCGGTTTAGATTTTGCCTTATAGCAAACTATAAT[T/C]
GGTAGAAATTGATCAATTATCGTCATGTGCACCAAAGTTGCACATTTTCTCCAACAAAATACTATTTAGTCATGAACCAACACGTCTCCCTTGTAGGAAA
TTTCCTACAAGGGAGACGTGTTGGTTCATGACTAAATAGTATTTTGTTGGAGAAAATGTGCAACTTTGGTGCACATGACGATAATTGATCAATTTCTACC[A/G]
ATTATAGTTTGCTATAAGGCAAAATCTAAACCGAGAGGCTTCTCGGTTTAGTGTTAACCAGCGACGAACGAATTGTGAGAAGAAGTACTGCTACATGTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.70% | 4.00% | 0.30% | 58.95% | NA |
| All Indica | 2759 | 3.60% | 3.10% | 0.40% | 92.97% | NA |
| All Japonica | 1512 | 98.20% | 0.00% | 0.00% | 1.79% | NA |
| Aus | 269 | 1.90% | 38.30% | 0.37% | 59.48% | NA |
| Indica I | 595 | 5.00% | 0.00% | 0.50% | 94.45% | NA |
| Indica II | 465 | 5.40% | 0.60% | 0.00% | 93.98% | NA |
| Indica III | 913 | 1.30% | 4.90% | 0.44% | 93.32% | NA |
| Indica Intermediate | 786 | 3.90% | 4.70% | 0.51% | 90.84% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 97.20% | 0.00% | 0.00% | 2.78% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 1.10% | 2.22% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211778484 | T -> DEL | N | N | silent_mutation | Average:23.297; most accessible tissue: Callus, score: 50.277 | N | N | N | N |
| vg0211778484 | T -> C | LOC_Os02g20010.1 | upstream_gene_variant ; 742.0bp to feature; MODIFIER | silent_mutation | Average:23.297; most accessible tissue: Callus, score: 50.277 | N | N | N | N |
| vg0211778484 | T -> C | LOC_Os02g20000.1 | downstream_gene_variant ; 542.0bp to feature; MODIFIER | silent_mutation | Average:23.297; most accessible tissue: Callus, score: 50.277 | N | N | N | N |
| vg0211778484 | T -> C | LOC_Os02g20000-LOC_Os02g20010 | intergenic_region ; MODIFIER | silent_mutation | Average:23.297; most accessible tissue: Callus, score: 50.277 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211778484 | 2.15E-08 | 9.46E-09 | mr1275 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211778484 | NA | 3.58E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211778484 | NA | 2.08E-09 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211778484 | 6.26E-06 | NA | mr1406 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211778484 | NA | 4.61E-07 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211778484 | NA | 2.93E-09 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |