\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211778484:

Variant ID: vg0211778484 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11778484
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCACATGTAGCAGTACTTCTTCTCACAATTCGTTCGTCGCTGGTTAACACTAAACCGAGAAGCCTCTCGGTTTAGATTTTGCCTTATAGCAAACTATAAT[T/C]
GGTAGAAATTGATCAATTATCGTCATGTGCACCAAAGTTGCACATTTTCTCCAACAAAATACTATTTAGTCATGAACCAACACGTCTCCCTTGTAGGAAA

Reverse complement sequence

TTTCCTACAAGGGAGACGTGTTGGTTCATGACTAAATAGTATTTTGTTGGAGAAAATGTGCAACTTTGGTGCACATGACGATAATTGATCAATTTCTACC[A/G]
ATTATAGTTTGCTATAAGGCAAAATCTAAACCGAGAGGCTTCTCGGTTTAGTGTTAACCAGCGACGAACGAATTGTGAGAAGAAGTACTGCTACATGTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.70% 4.00% 0.30% 58.95% NA
All Indica  2759 3.60% 3.10% 0.40% 92.97% NA
All Japonica  1512 98.20% 0.00% 0.00% 1.79% NA
Aus  269 1.90% 38.30% 0.37% 59.48% NA
Indica I  595 5.00% 0.00% 0.50% 94.45% NA
Indica II  465 5.40% 0.60% 0.00% 93.98% NA
Indica III  913 1.30% 4.90% 0.44% 93.32% NA
Indica Intermediate  786 3.90% 4.70% 0.51% 90.84% NA
Temperate Japonica  767 99.00% 0.00% 0.00% 1.04% NA
Tropical Japonica  504 97.20% 0.00% 0.00% 2.78% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 58.90% 1.10% 2.22% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211778484 T -> DEL N N silent_mutation Average:23.297; most accessible tissue: Callus, score: 50.277 N N N N
vg0211778484 T -> C LOC_Os02g20010.1 upstream_gene_variant ; 742.0bp to feature; MODIFIER silent_mutation Average:23.297; most accessible tissue: Callus, score: 50.277 N N N N
vg0211778484 T -> C LOC_Os02g20000.1 downstream_gene_variant ; 542.0bp to feature; MODIFIER silent_mutation Average:23.297; most accessible tissue: Callus, score: 50.277 N N N N
vg0211778484 T -> C LOC_Os02g20000-LOC_Os02g20010 intergenic_region ; MODIFIER silent_mutation Average:23.297; most accessible tissue: Callus, score: 50.277 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211778484 2.15E-08 9.46E-09 mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484 NA 3.58E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484 NA 2.08E-09 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484 6.26E-06 NA mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484 NA 4.61E-07 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211778484 NA 2.93E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251