\
| Variant ID: vg0211628824 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11628824 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 72. )
AAACTGTCTTTGGTGGGGTCCACTTTGTAACTGACTCCACATTCGATGGATCCACTGCCACACGTTGAGTAGTAATGACGCGACCCAGAAATTTGACTTC[T/C]
GACAACCAGAAGTCACACTTACTGAACTTGGCATATAACTGGTGCTCCTTCAATTTCTTGAGTACCAGACGGAGATGTTGCTCATGTTCTTCTTCAGACT
AGTCTGAAGAAGAACATGAGCAACATCTCCGTCTGGTACTCAAGAAATTGAAGGAGCACCAGTTATATGCCAAGTTCAGTAAGTGTGACTTCTGGTTGTC[A/G]
GAAGTCAAATTTCTGGGTCGCGTCATTACTACTCAACGTGTGGCAGTGGATCCATCGAATGTGGAGTCAGTTACAAAGTGGACCCCACCAAAGACAGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 36.70% | 3.32% | 3.09% | NA |
| All Indica | 2759 | 87.10% | 3.50% | 4.75% | 4.71% | NA |
| All Japonica | 1512 | 1.50% | 98.10% | 0.33% | 0.00% | NA |
| Aus | 269 | 84.80% | 3.70% | 6.32% | 5.20% | NA |
| Indica I | 595 | 86.40% | 1.50% | 7.06% | 5.04% | NA |
| Indica II | 465 | 87.30% | 3.90% | 4.30% | 4.52% | NA |
| Indica III | 913 | 89.50% | 2.80% | 3.29% | 4.38% | NA |
| Indica Intermediate | 786 | 84.60% | 5.50% | 4.96% | 4.96% | NA |
| Temperate Japonica | 767 | 0.90% | 98.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 53.30% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211628824 | T -> DEL | LOC_Os02g19840.1 | N | frameshift_variant | Average:35.148; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg0211628824 | T -> C | LOC_Os02g19840.1 | synonymous_variant ; p.Ser559Ser; LOW | synonymous_codon | Average:35.148; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211628824 | NA | 3.13E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 1.60E-23 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 2.37E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 3.26E-42 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 1.36E-36 | mr1647 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 3.08E-37 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 2.22E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 4.29E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 2.58E-22 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 6.85E-14 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 5.96E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 8.60E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211628824 | NA | 3.08E-18 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |