\
| Variant ID: vg0211612218 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11612218 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 85. )
TACAAAACCAAGCATTTTACACCCTCAATTGTTTATACCGGACAAATAACCCCCCTCAACACTGTTTCGAGTGGTTTTAACTTGAACGTGCACACGTGGC[G/A]
CCAACGTGGAAATTCAGTCAACAAAAAAAATAAAAAAACTTCCCAGGGGCCCACCTGTCATACCCCTCCCTCAACCTAATCCTTCCCTGTCGCGCAATCT
AGATTGCGCGACAGGGAAGGATTAGGTTGAGGGAGGGGTATGACAGGTGGGCCCCTGGGAAGTTTTTTTATTTTTTTTGTTGACTGAATTTCCACGTTGG[C/T]
GCCACGTGTGCACGTTCAAGTTAAAACCACTCGAAACAGTGTTGAGGGGGGTTATTTGTCCGGTATAAACAATTGAGGGTGTAAAATGCTTGGTTTTGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 6.50% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 88.10% | 10.80% | 1.09% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 71.60% | 24.90% | 3.44% | 0.00% | NA |
| Indica III | 913 | 85.20% | 14.20% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 6.60% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211612218 | G -> A | LOC_Os02g19830.1 | upstream_gene_variant ; 4437.0bp to feature; MODIFIER | silent_mutation | Average:63.103; most accessible tissue: Zhenshan97 young leaf, score: 78.347 | N | N | N | N |
| vg0211612218 | G -> A | LOC_Os02g19820-LOC_Os02g19830 | intergenic_region ; MODIFIER | silent_mutation | Average:63.103; most accessible tissue: Zhenshan97 young leaf, score: 78.347 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211612218 | NA | 7.25E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211612218 | 1.38E-08 | 2.81E-09 | mr1818 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211612218 | NA | 1.81E-09 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211612218 | NA | 5.77E-08 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211612218 | NA | 4.27E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211612218 | NA | 1.65E-07 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211612218 | NA | 8.03E-07 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211612218 | NA | 2.26E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |