Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211600666:

Variant ID: vg0211600666 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11600666
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTGGCTGGTCAAAACGCACGGCACATATTCCAAAGACGAGAGAGCTATAGCACCCGGGATTTTTTTATACGTGCAGCGCAGCTGATCTATACCCGTT[A/G]
CCGTGTCGAATCTTGCATTGCGTTTGGTTCATCATCGATCCCATTGTCAACCCTATCTATCTATCTATCTATCTGCTGTATTATCGCGTACGTACACGTA

Reverse complement sequence

TACGTGTACGTACGCGATAATACAGCAGATAGATAGATAGATAGATAGGGTTGACAATGGGATCGATGATGAACCAAACGCAATGCAAGATTCGACACGG[T/C]
AACGGGTATAGATCAGCTGCGCTGCACGTATAAAAAAATCCCGGGTGCTATAGCTCTCTCGTCTTTGGAATATGTGCCGTGCGTTTTGACCAGCCAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 14.30% 1.59% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 53.60% 41.40% 4.96% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 76.40% 16.00% 7.56% 0.00% NA
Tropical Japonica  504 24.60% 73.60% 1.79% 0.00% NA
Japonica Intermediate  241 41.90% 54.80% 3.32% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211600666 A -> G LOC_Os02g19820.1 upstream_gene_variant ; 4215.0bp to feature; MODIFIER silent_mutation Average:86.866; most accessible tissue: Minghui63 panicle, score: 98.83 N N N N
vg0211600666 A -> G LOC_Os02g19820-LOC_Os02g19830 intergenic_region ; MODIFIER silent_mutation Average:86.866; most accessible tissue: Minghui63 panicle, score: 98.83 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0211600666 A G 0.04 0.04 0.02 -0.04 0.02 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211600666 NA 9.23E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 6.44E-14 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 3.97E-17 mr1205 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 1.51E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 8.99E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 3.66E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 1.87E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 2.13E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 6.13E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 1.60E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 9.07E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 9.07E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 4.02E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 9.47E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211600666 NA 3.80E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251