\
| Variant ID: vg0211585441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11585441 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGTCATATAGGTCTCTAAACTCTCAAAATACATATCCAGATCCTAAAACTTATCAAAGTGTATCATCTATGTCCCAAATCAACACATCCCCTCTAGGATT[C/A]
TACGTAACGCTGATATGGCATACCACATGGACATGACGTGATGTGTCCTTTTTTTCCATCTTTTCTTTTTCTTTTTCTTCTCATTCTTCTTTTTTTTTTC
GAAAAAAAAAAGAAGAATGAGAAGAAAAAGAAAAAGAAAAGATGGAAAAAAAGGACACATCACGTCATGTCCATGTGGTATGCCATATCAGCGTTACGTA[G/T]
AATCCTAGAGGGGATGTGTTGATTTGGGACATAGATGATACACTTTGATAAGTTTTAGGATCTGGATATGTATTTTGAGAGTTTAGAGACCTATATGACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 35.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211585441 | C -> A | LOC_Os02g19804.1 | downstream_gene_variant ; 1850.0bp to feature; MODIFIER | silent_mutation | Average:46.132; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0211585441 | C -> A | LOC_Os02g19804-LOC_Os02g19820 | intergenic_region ; MODIFIER | silent_mutation | Average:46.132; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211585441 | 4.04E-06 | NA | mr1267_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211585441 | 5.98E-06 | 5.98E-06 | mr1267_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211585441 | NA | 2.67E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211585441 | NA | 2.78E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211585441 | NA | 2.99E-07 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |