\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211547954:

Variant ID: vg0211547954 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11547954
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGCTTGACGACGAGCACCGGATTGCGAGACAGCCGCTCCACTTGCTGCGCAGTTCACCGAGATCTTCCCGAAGGTCGGTCATGGCCTGATCCACCGC[T/C,A]
GGTTTCCAGCTGGTCAACTCCACCACCATGGGCTTGATTTCTTCCAAGGATCCAACCGAGGCTTGGATGGCAGAGTTCTGCTTCTGAATCATTGCCATGG

Reverse complement sequence

CCATGGCAATGATTCAGAAGCAGAACTCTGCCATCCAAGCCTCGGTTGGATCCTTGGAAGAAATCAAGCCCATGGTGGTGGAGTTGACCAGCTGGAAACC[A/G,T]
GCGGTGGATCAGGCCATGACCGACCTTCGGGAAGATCTCGGTGAACTGCGCAGCAAGTGGAGCGGCTGTCTCGCAATCCGGTGCTCGTCGTCAAGCCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 32.80% 0.83% 1.67% NA
All Indica  2759 94.90% 1.10% 1.23% 2.83% NA
All Japonica  1512 8.60% 91.20% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 0.20% 2.86% 1.18% NA
Indica II  465 90.80% 2.20% 0.43% 6.67% NA
Indica III  913 97.30% 0.40% 0.55% 1.75% NA
Indica Intermediate  786 93.80% 1.90% 1.27% 3.05% NA
Temperate Japonica  767 11.00% 88.70% 0.39% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 11.60% 88.40% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 47.80% 48.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211547954 T -> A LOC_Os02g19740.1 upstream_gene_variant ; 1045.0bp to feature; MODIFIER N Average:76.398; most accessible tissue: Minghui63 flag leaf, score: 89.621 N N N N
vg0211547954 T -> A LOC_Os02g19750.1 upstream_gene_variant ; 3021.0bp to feature; MODIFIER N Average:76.398; most accessible tissue: Minghui63 flag leaf, score: 89.621 N N N N
vg0211547954 T -> A LOC_Os02g19730.1 intron_variant ; MODIFIER N Average:76.398; most accessible tissue: Minghui63 flag leaf, score: 89.621 N N N N
vg0211547954 T -> DEL N N silent_mutation Average:76.398; most accessible tissue: Minghui63 flag leaf, score: 89.621 N N N N
vg0211547954 T -> C LOC_Os02g19740.1 upstream_gene_variant ; 1045.0bp to feature; MODIFIER silent_mutation Average:76.398; most accessible tissue: Minghui63 flag leaf, score: 89.621 N N N N
vg0211547954 T -> C LOC_Os02g19750.1 upstream_gene_variant ; 3021.0bp to feature; MODIFIER silent_mutation Average:76.398; most accessible tissue: Minghui63 flag leaf, score: 89.621 N N N N
vg0211547954 T -> C LOC_Os02g19730.1 intron_variant ; MODIFIER silent_mutation Average:76.398; most accessible tissue: Minghui63 flag leaf, score: 89.621 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0211547954 T A 0.01 -0.01 0.0 0.01 0.01 0.01
vg0211547954 T C 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211547954 NA 1.59E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 3.25E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 3.87E-46 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 2.48E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 3.55E-13 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 9.68E-48 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 1.11E-54 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 3.05E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 5.23E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 5.94E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 7.29E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 2.19E-33 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 1.19E-43 mr1092_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 7.14E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 9.09E-16 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 4.31E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 6.33E-43 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 4.04E-52 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 1.92E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 3.37E-34 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 5.24E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 7.17E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211547954 NA 4.91E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251