\
| Variant ID: vg0211536788 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11536788 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.13, others allele: 0.00, population size: 111. )
AATTAGATTTTAAGTTCGATTGCTTTGGAAATATAAAAGGAGTTGTATAATAAATTTTTTAAAGAAAAAACTCACATGCTAACTTGAGACGAAAGTCGGA[T/C]
TTCTAATTACAGCTCATGATTTTCTAAAAAAAATATATCCAAGCGAATTCCAACGGTGAATTTTACCCTAGCTATACCGTATAACAATAATAAGATTAAA
TTTAATCTTATTATTGTTATACGGTATAGCTAGGGTAAAATTCACCGTTGGAATTCGCTTGGATATATTTTTTTTAGAAAATCATGAGCTGTAATTAGAA[A/G]
TCCGACTTTCGTCTCAAGTTAGCATGTGAGTTTTTTCTTTAAAAAATTTATTATACAACTCCTTTTATATTTCCAAAGCAATCGAACTTAAAATCTAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.90% | 25.90% | 23.17% | 18.01% | NA |
| All Indica | 2759 | 1.40% | 33.60% | 36.06% | 28.96% | NA |
| All Japonica | 1512 | 91.30% | 7.50% | 0.79% | 0.40% | NA |
| Aus | 269 | 0.00% | 62.10% | 24.16% | 13.75% | NA |
| Indica I | 595 | 0.30% | 32.90% | 45.21% | 21.51% | NA |
| Indica II | 465 | 2.60% | 29.50% | 35.27% | 32.69% | NA |
| Indica III | 913 | 0.90% | 36.90% | 30.12% | 32.09% | NA |
| Indica Intermediate | 786 | 2.00% | 32.70% | 36.51% | 28.75% | NA |
| Temperate Japonica | 767 | 88.80% | 10.60% | 0.52% | 0.13% | NA |
| Tropical Japonica | 504 | 96.40% | 1.40% | 1.19% | 0.99% | NA |
| Japonica Intermediate | 241 | 88.40% | 10.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 16.70% | 24.44% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211536788 | T -> DEL | N | N | silent_mutation | Average:36.92; most accessible tissue: Zhenshan97 root, score: 50.453 | N | N | N | N |
| vg0211536788 | T -> C | LOC_Os02g19720.1 | downstream_gene_variant ; 639.0bp to feature; MODIFIER | silent_mutation | Average:36.92; most accessible tissue: Zhenshan97 root, score: 50.453 | N | N | N | N |
| vg0211536788 | T -> C | LOC_Os02g19710-LOC_Os02g19720 | intergenic_region ; MODIFIER | silent_mutation | Average:36.92; most accessible tissue: Zhenshan97 root, score: 50.453 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211536788 | NA | 2.80E-68 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.68E-13 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 7.64E-44 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.83E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 3.85E-14 | mr1128 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.38E-46 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.48E-54 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 5.73E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 2.20E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.18E-25 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.05E-06 | mr1897 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.02E-40 | mr1092_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 2.75E-16 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 4.29E-40 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.08E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | 1.83E-06 | 8.45E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211536788 | NA | 1.85E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |