\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211536788:

Variant ID: vg0211536788 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11536788
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.13, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAGATTTTAAGTTCGATTGCTTTGGAAATATAAAAGGAGTTGTATAATAAATTTTTTAAAGAAAAAACTCACATGCTAACTTGAGACGAAAGTCGGA[T/C]
TTCTAATTACAGCTCATGATTTTCTAAAAAAAATATATCCAAGCGAATTCCAACGGTGAATTTTACCCTAGCTATACCGTATAACAATAATAAGATTAAA

Reverse complement sequence

TTTAATCTTATTATTGTTATACGGTATAGCTAGGGTAAAATTCACCGTTGGAATTCGCTTGGATATATTTTTTTTAGAAAATCATGAGCTGTAATTAGAA[A/G]
TCCGACTTTCGTCTCAAGTTAGCATGTGAGTTTTTTCTTTAAAAAATTTATTATACAACTCCTTTTATATTTCCAAAGCAATCGAACTTAAAATCTAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.90% 25.90% 23.17% 18.01% NA
All Indica  2759 1.40% 33.60% 36.06% 28.96% NA
All Japonica  1512 91.30% 7.50% 0.79% 0.40% NA
Aus  269 0.00% 62.10% 24.16% 13.75% NA
Indica I  595 0.30% 32.90% 45.21% 21.51% NA
Indica II  465 2.60% 29.50% 35.27% 32.69% NA
Indica III  913 0.90% 36.90% 30.12% 32.09% NA
Indica Intermediate  786 2.00% 32.70% 36.51% 28.75% NA
Temperate Japonica  767 88.80% 10.60% 0.52% 0.13% NA
Tropical Japonica  504 96.40% 1.40% 1.19% 0.99% NA
Japonica Intermediate  241 88.40% 10.80% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 48.90% 16.70% 24.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211536788 T -> DEL N N silent_mutation Average:36.92; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N
vg0211536788 T -> C LOC_Os02g19720.1 downstream_gene_variant ; 639.0bp to feature; MODIFIER silent_mutation Average:36.92; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N
vg0211536788 T -> C LOC_Os02g19710-LOC_Os02g19720 intergenic_region ; MODIFIER silent_mutation Average:36.92; most accessible tissue: Zhenshan97 root, score: 50.453 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211536788 NA 2.80E-68 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.68E-13 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 7.64E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.83E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 3.85E-14 mr1128 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.38E-46 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.48E-54 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 5.73E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 2.20E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.18E-25 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.05E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.02E-40 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 2.75E-16 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 4.29E-40 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.08E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 1.83E-06 8.45E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211536788 NA 1.85E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251