Search for Variation information by Variation ID:
Detailed information for vg0211330175:
| Variant ID: vg0211330175 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11330175 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CCGCGCCAAGGAAGCCGACGACGATTTCACGATCTCGCCGACCTCCTCCTCCAGCCTCTCCAGATCCGCCGCCAGCCTGTCCAGCCGGAGCGCGAGTGCC[G/A]
GCTGTGTGGGCGGGAGCTTACTATCCCGGCGCACGGAGATGCCGACTCGGCGCCTCGCGCGCTCCAGCCGATCGACGGCATCGGAGAACTGCCCGGGTCC
Reverse complement sequence
GGACCCGGGCAGTTCTCCGATGCCGTCGATCGGCTGGAGCGCGCGAGGCGCCGAGTCGGCATCTCCGTGCGCCGGGATAGTAAGCTCCCGCCCACACAGC[C/T]
GGCACTCGCGCTCCGGCTGGACAGGCTGGCGGCGGATCTGGAGAGGCTGGAGGAGGAGGTCGGCGAGATCGTGAAATCGTCGTCGGCTTCCTTGGCGCGG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.20% | 14.50% | 4.61% | 20.67% | NA |
| All Indica | 2759 | 39.10% | 19.70% | 7.50% | 33.71% | NA |
| All Japonica | 1512 | 90.00% | 8.80% | 0.13% | 1.06% | NA |
| Aus | 269 | 92.60% | 1.90% | 1.86% | 3.72% | NA |
| Indica I | 595 | 19.80% | 17.10% | 7.39% | 55.63% | NA |
| Indica II | 465 | 40.20% | 9.90% | 7.96% | 41.94% | NA |
| Indica III | 913 | 47.00% | 32.30% | 7.12% | 13.58% | NA |
| Indica Intermediate | 786 | 43.90% | 12.70% | 7.76% | 35.62% | NA |
| Temperate Japonica | 767 | 98.30% | 0.90% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 75.00% | 23.00% | 0.20% | 1.79% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.10% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 4.40% | 4.44% | 23.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211330175 | G -> A | LOC_Os02g19400.1 | missense_variant ; p.Pro837Leu; MODERATE | nonsynonymous_codon ; P837L | Average:35.224; most accessible tissue: Minghui63 panicle, score: 64.459 | probably damaging  |
2.029 |
TOLERATED | 0.07 |
| vg0211330175 | G -> DEL | LOC_Os02g19400.1 | N | frameshift_variant | Average:35.224; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211330175 | 1.34E-06 | NA | mr1281 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | 1.99E-07 | 2.42E-07 | mr1281 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | NA | 9.85E-06 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | NA | 3.14E-07 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | NA | 1.81E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | 7.35E-06 | 7.35E-06 | mr1556 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | 9.27E-06 | 5.41E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | NA | 5.90E-06 | mr1610 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | 2.04E-06 | 2.43E-07 | mr1783 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | 2.95E-06 | 2.95E-06 | mr1783 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211330175 | NA | 5.49E-06 | mr1964 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |