\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211327076:

Variant ID: vg0211327076 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11327076
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCCCCCGAAGTTTCGCCCCAACCTTACGGAGAAGTATGATGGCAGCATCAATCCCTCCGAGTTCCTCCAGATCTACACCACGATCATCGTAGCGGCA[A/G,T]
GGGGCGATGACCGGGTCATGGCGAATTATTTCCCCATGGCCCTCAAGGGTCAGGCGCGTGGCTGGTTGATGACCCAGCCCCCCGACTCCATCTACTCCTG

Reverse complement sequence

CAGGAGTAGATGGAGTCGGGGGGCTGGGTCATCAACCAGCCACGCGCCTGACCCTTGAGGGCCATGGGGAAATAATTCGCCATGACCCGGTCATCGCCCC[T/C,A]
TGCCGCTACGATGATCGTGGTGTAGATCTGGAGGAACTCGGAGGGATTGATGCTGCCATCATACTTCTCCGTAAGGTTGGGGCGAAACTTCGGGGGCCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 11.80% 12.12% 39.95% T: 0.04%
All Indica  2759 2.90% 12.80% 19.72% 64.48% T: 0.07%
All Japonica  1512 98.40% 0.10% 0.13% 1.32% NA
Aus  269 1.10% 73.60% 6.69% 18.59% NA
Indica I  595 2.70% 2.90% 13.28% 81.18% NA
Indica II  465 3.20% 5.60% 17.42% 73.76% NA
Indica III  913 1.80% 23.20% 27.05% 47.75% T: 0.22%
Indica Intermediate  786 4.20% 12.60% 17.43% 65.78% NA
Temperate Japonica  767 99.20% 0.00% 0.00% 0.78% NA
Tropical Japonica  504 97.20% 0.20% 0.40% 2.18% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 91.70% 1.00% 2.08% 5.21% NA
Intermediate  90 51.10% 3.30% 7.78% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211327076 A -> G LOC_Os02g19390.1 missense_variant ; p.Arg75Gly; MODERATE nonsynonymous_codon ; R75G Average:19.941; most accessible tissue: Zhenshan97 root, score: 25.639 probably damaging -2.607 TOLERATED 1.00
vg0211327076 A -> T LOC_Os02g19390.1 missense_variant ; p.Arg75Trp; MODERATE nonsynonymous_codon ; R75W Average:19.941; most accessible tissue: Zhenshan97 root, score: 25.639 benign 1.164 DELETERIOUS 0.00
vg0211327076 A -> DEL LOC_Os02g19390.1 N frameshift_variant Average:19.941; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211327076 NA 1.35E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 4.14E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 4.89E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 8.12E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 8.13E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 1.24E-38 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 3.40E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 2.40E-38 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 4.38E-19 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 2.54E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 6.17E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 1.28E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 8.15E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 1.07E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 1.19E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 6.29E-46 mr1591_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 2.82E-21 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 9.36E-26 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 2.02E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 7.91E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 1.96E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 6.96E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 7.17E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 2.10E-06 1.75E-35 mr1891_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076 NA 1.59E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251