Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211327076:

Variant ID: vg0211327076 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11327076
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGCCCCCGAAGTTTCGCCCCAACCTTACGGAGAAGTATGATGGCAGCATCAATCCCTCCGAGTTCCTCCAGATCTACACCACGATCATCGTAGCGGCA[A/G,T]
GGGGCGATGACCGGGTCATGGCGAATTATTTCCCCATGGCCCTCAAGGGTCAGGCGCGTGGCTGGTTGATGACCCAGCCCCCCGACTCCATCTACTCCTG

Reverse complement sequence

CAGGAGTAGATGGAGTCGGGGGGCTGGGTCATCAACCAGCCACGCGCCTGACCCTTGAGGGCCATGGGGAAATAATTCGCCATGACCCGGTCATCGCCCC[T/C,A]
TGCCGCTACGATGATCGTGGTGTAGATCTGGAGGAACTCGGAGGGATTGATGCTGCCATCATACTTCTCCGTAAGGTTGGGGCGAAACTTCGGGGGCCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.10%	11.80%	12.12%	39.95%	T: 0.04%
All Indica	2759	2.90%	12.80%	19.72%	64.48%	T: 0.07%
All Japonica	1512	98.40%	0.10%	0.13%	1.32%	NA
Aus	269	1.10%	73.60%	6.69%	18.59%	NA
Indica I	595	2.70%	2.90%	13.28%	81.18%	NA
Indica II	465	3.20%	5.60%	17.42%	73.76%	NA
Indica III	913	1.80%	23.20%	27.05%	47.75%	T: 0.22%
Indica Intermediate	786	4.20%	12.60%	17.43%	65.78%	NA
Temperate Japonica	767	99.20%	0.00%	0.00%	0.78%	NA
Tropical Japonica	504	97.20%	0.20%	0.40%	2.18%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	91.70%	1.00%	2.08%	5.21%	NA
Intermediate	90	51.10%	3.30%	7.78%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211327076	A -> G	LOC_Os02g19390.1	missense_variant ; p.Arg75Gly; MODERATE	nonsynonymous_codon ; R75G	Average:19.941; most accessible tissue: Zhenshan97 root, score: 25.639	probably damaging	-2.607	TOLERATED	1.00
vg0211327076	A -> T	LOC_Os02g19390.1	missense_variant ; p.Arg75Trp; MODERATE	nonsynonymous_codon ; R75W	Average:19.941; most accessible tissue: Zhenshan97 root, score: 25.639	benign	1.164	DELETERIOUS	0.00
vg0211327076	A -> DEL	LOC_Os02g19390.1	N	frameshift_variant	Average:19.941; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211327076	NA	1.35E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	4.14E-36	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	4.89E-42	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	8.12E-58	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	8.13E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	1.24E-38	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	3.40E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	2.40E-38	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	4.38E-19	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	2.54E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	6.17E-18	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	1.28E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	8.15E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	1.07E-36	mr1541_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	1.19E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	6.29E-46	mr1591_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	2.82E-21	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	9.36E-26	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	2.02E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	7.91E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	1.96E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	6.96E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	7.17E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	2.10E-06	1.75E-35	mr1891_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211327076	NA	1.59E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251