Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0211295378:

Variant ID: vg0211295378 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11295378
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAGGGTACGAAATGAATGATGATTTAGGTACCGGAATTGGTTCTGTGTGATTGTATTGAGGCTCTTGTTGTGGGTATGATGAAGTTCTATGCAACAGA[T/G]
ATGGCATTGCTCCAAGAATATGTTCATTAGGATTGTATTGAGCATCTTGCTGCGGCGATGAGGATGTTCTGTGCAGTCTAGAATCAGCAAAGCGGGCTAA

Reverse complement sequence

TTAGCCCGCTTTGCTGATTCTAGACTGCACAGAACATCCTCATCGCCGCAGCAAGATGCTCAATACAATCCTAATGAACATATTCTTGGAGCAATGCCAT[A/C]
TCTGTTGCATAGAACTTCATCATACCCACAACAAGAGCCTCAATACAATCACACAGAACCAATTCCGGTACCTAAATCATCATTCATTTCGTACCCTCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	28.80%	0.89%	0.00%	NA
All Indica	2759	98.80%	1.10%	0.11%	0.00%	NA
All Japonica	1512	17.90%	79.60%	2.45%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	98.20%	1.50%	0.25%	0.00%	NA
Temperate Japonica	767	12.60%	82.90%	4.43%	0.00%	NA
Tropical Japonica	504	26.80%	73.20%	0.00%	0.00%	NA
Japonica Intermediate	241	16.20%	82.60%	1.24%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	56.70%	41.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211295378	T -> G	LOC_Os02g19330.1	missense_variant ; p.Tyr176Ser; MODERATE	nonsynonymous_codon ; Y176S	Average:70.809; most accessible tissue: Minghui63 flag leaf, score: 81.312	probably damaging	-2.325	TOLERATED	0.41
vg0211295378	T -> G	LOC_Os02g19330.2	missense_variant ; p.Tyr176Ser; MODERATE	nonsynonymous_codon ; Y176S	Average:70.809; most accessible tissue: Minghui63 flag leaf, score: 81.312	probably damaging	-2.325	TOLERATED	0.41

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211295378	NA	1.74E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.11E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.29E-06	mr1030_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.77E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	7.07E-16	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.73E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	3.15E-06	3.15E-06	mr1046_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	4.88E-06	mr1148_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	7.81E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.35E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	5.49E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.54E-18	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.72E-06	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.08E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	8.00E-07	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	6.35E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.39E-06	mr1381_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	7.76E-14	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.85E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	7.10E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.25E-12	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.92E-11	mr1600_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.67E-06	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.10E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.63E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	3.52E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.78E-15	mr1713_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	5.71E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	5.38E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	3.08E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	8.17E-06	5.25E-11	mr1783_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	4.04E-08	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	3.09E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.66E-10	mr1804_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.73E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.54E-17	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	2.89E-30	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	7.51E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	9.05E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211295378	NA	1.47E-07	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251