Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211265995:

Variant ID: vg0211265995 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 11265995
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTATTTGTGACTTTTACTTGCAATTCTAAGTGGCAAGAAATATACGATGCATTGTTGTTTGAACCAGGCCAGGTACCAAGCGACCGTTCTGATATGAT[T/C]
GTTAGAGTTTTCAACATGAAAGTAGACGAGTTTATCTCGGACATTAAGGAAGGAAAGACATTTGGCCCAGTCCTTGCTGGTAGGCTTTTTGTTTTTGCTC

Reverse complement sequence

GAGCAAAAACAAAAAGCCTACCAGCAAGGACTGGGCCAAATGTCTTTCCTTCCTTAATGTCCGAGATAAACTCGTCTACTTTCATGTTGAAAACTCTAAC[A/G]
ATCATATCAGAACGGTCGCTTGGTACCTGGCCTGGTTCAAACAACAATGCATCGTATATTTCTTGCCACTTAGAATTGCAAGTAAAAGTCACAAATAGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.50%	0.42%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	82.90%	15.90%	1.19%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	96.70%	2.70%	0.52%	0.00%	NA
Tropical Japonica	504	60.30%	37.50%	2.18%	0.00%	NA
Japonica Intermediate	241	86.30%	12.40%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0211265995	T -> C	LOC_Os02g19280.1	synonymous_variant ; p.Ile165Ile; LOW	synonymous_codon	Average:69.486; most accessible tissue: Zhenshan97 young leaf, score: 86.055	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0211265995	NA	2.54E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	3.76E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	4.67E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	3.75E-31	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	1.39E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	9.36E-13	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	1.17E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	2.91E-08	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	9.64E-07	NA	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	2.57E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	2.50E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	3.89E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	3.63E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	2.28E-07	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	1.62E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	4.01E-07	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	1.15E-10	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	2.60E-06	NA	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	9.07E-06	1.57E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	5.40E-06	5.53E-23	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	3.10E-11	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	9.08E-10	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	3.87E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	9.59E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	4.62E-11	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	6.15E-06	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	2.97E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	7.54E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	1.12E-07	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	2.59E-06	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	9.07E-12	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	1.21E-06	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	2.25E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	3.22E-06	NA	mr1929_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	NA	3.37E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211265995	7.30E-06	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251