\
| Variant ID: vg0211265995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11265995 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 327. )
ACCTATTTGTGACTTTTACTTGCAATTCTAAGTGGCAAGAAATATACGATGCATTGTTGTTTGAACCAGGCCAGGTACCAAGCGACCGTTCTGATATGAT[T/C]
GTTAGAGTTTTCAACATGAAAGTAGACGAGTTTATCTCGGACATTAAGGAAGGAAAGACATTTGGCCCAGTCCTTGCTGGTAGGCTTTTTGTTTTTGCTC
GAGCAAAAACAAAAAGCCTACCAGCAAGGACTGGGCCAAATGTCTTTCCTTCCTTAATGTCCGAGATAAACTCGTCTACTTTCATGTTGAAAACTCTAAC[A/G]
ATCATATCAGAACGGTCGCTTGGTACCTGGCCTGGTTCAAACAACAATGCATCGTATATTTCTTGCCACTTAGAATTGCAAGTAAAAGTCACAAATAGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.50% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 82.90% | 15.90% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 2.70% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 60.30% | 37.50% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 12.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211265995 | T -> C | LOC_Os02g19280.1 | synonymous_variant ; p.Ile165Ile; LOW | synonymous_codon | Average:69.486; most accessible tissue: Zhenshan97 young leaf, score: 86.055 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211265995 | NA | 2.54E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 3.76E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 4.67E-10 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 3.75E-31 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 1.39E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 9.36E-13 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 1.17E-14 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 2.91E-08 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 9.64E-07 | NA | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 2.57E-08 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 2.50E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 3.89E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 3.63E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 2.28E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 1.62E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 4.01E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 1.15E-10 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 2.60E-06 | NA | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 9.07E-06 | 1.57E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 5.40E-06 | 5.53E-23 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 3.10E-11 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 9.08E-10 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 3.87E-08 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 9.59E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 4.62E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 6.15E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 2.97E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 7.54E-07 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 1.12E-07 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 2.59E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 9.07E-12 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 1.21E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 2.25E-10 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 3.22E-06 | NA | mr1929_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | NA | 3.37E-10 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211265995 | 7.30E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |